Sidebar

IEU GWAS information

Trait: Heterogeneous nuclear ribonucleoproteins A2/B1.

name	value
id	PROT-a-1361
trait	Heterogeneous nuclear ribonucleoproteins A2/B1
pmid	29875488
year	2018
author	Sun BB
population	European
sex	Males and Females
sample_size	3301
build	HG19/GRCh37
group_name	public
access	public
nsnp	10534735
mr	1
category	Immune system
subcategory	Protein
batch	PROT-a

Report information

name	value
gwas_id	prot-a-1361
bcf_file	prot-a-1361.vcf.gz
qc_metrics_file	qc_metrics.json
metadata	metadata.json
refdata	1kg_v3_nomult.bcf
compile_time	2020-05-10 06:59 BST
build_version	run_igd-8f4f4c9-2020-05-09

Summary

Summary {data-width=650}

Manhattan plot

manhattan_plot

QQ plot

qq_plot

AF plot

af_plot

P-Z plot

pz_plot

beta_std plot

beta_std_plot

Metadata

{
    "fileformat": "VCFv4.2",
    "FILTER": "<ID=PASS,Description=\"All filters passed\">",
    "INFO": "<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency\">",
    "FORMAT": "<ID=ES,Number=A,Type=Float,Description=\"Effect size estimate relative to the alternative allele\">",
    "FORMAT.1": "<ID=SE,Number=A,Type=Float,Description=\"Standard error of effect size estimate\">",
    "FORMAT.2": "<ID=LP,Number=A,Type=Float,Description=\"-log10 p-value for effect estimate\">",
    "FORMAT.3": "<ID=AF,Number=A,Type=Float,Description=\"Alternate allele frequency in the association study\">",
    "FORMAT.4": "<ID=SS,Number=A,Type=Float,Description=\"Sample size used to estimate genetic effect\">",
    "FORMAT.5": "<ID=EZ,Number=A,Type=Float,Description=\"Z-score provided if it was used to derive the EFFECT and SE fields\">",
    "FORMAT.6": "<ID=SI,Number=A,Type=Float,Description=\"Accuracy score of summary data imputation\">",
    "FORMAT.7": "<ID=NC,Number=A,Type=Float,Description=\"Number of cases used to estimate genetic effect\">",
    "FORMAT.8": "<ID=ID,Number=1,Type=String,Description=\"Study variant identifier\">",
    "META": "<ID=TotalVariants,Number=1,Type=Integer,Description=\"Total number of variants in input\">",
    "META.1": "<ID=VariantsNotRead,Number=1,Type=Integer,Description=\"Number of variants that could not be read\">",
    "META.2": "<ID=HarmonisedVariants,Number=1,Type=Integer,Description=\"Total number of harmonised variants\">",
    "META.3": "<ID=VariantsNotHarmonised,Number=1,Type=Integer,Description=\"Total number of variants that could not be harmonised\">",
    "META.4": "<ID=SwitchedAlleles,Number=1,Type=Integer,Description=\"Total number of variants strand switched\">",
    "META.5": "<ID=TotalControls,Number=1,Type=Integer,Description=\"Total number of controls in the association study\">",
    "META.6": "<ID=TotalCases,Number=1,Type=Integer,Description=\"Total number of cases in the association study\">",
    "META.7": "<ID=StudyType,Number=1,Type=String,Description=\"Type of GWAS study [Continuous or CaseControl]\">",
    "SAMPLE": "<ID=PROT-a-1361,TotalVariants=10283233,VariantsNotRead=0,HarmonisedVariants=10265284,VariantsNotHarmonised=17949,SwitchedAlleles=4297153,TotalControls=3301.0,StudyType=Continuous>",
    "contig": "<ID=1,length=249250621,assembly=HG19/GRCh37>",
    "contig.1": "<ID=2,length=243199373,assembly=HG19/GRCh37>",
    "contig.2": "<ID=3,length=198022430,assembly=HG19/GRCh37>",
    "contig.3": "<ID=4,length=191154276,assembly=HG19/GRCh37>",
    "contig.4": "<ID=5,length=180915260,assembly=HG19/GRCh37>",
    "contig.5": "<ID=6,length=171115067,assembly=HG19/GRCh37>",
    "contig.6": "<ID=7,length=159138663,assembly=HG19/GRCh37>",
    "contig.7": "<ID=8,length=146364022,assembly=HG19/GRCh37>",
    "contig.8": "<ID=9,length=141213431,assembly=HG19/GRCh37>",
    "contig.9": "<ID=10,length=135534747,assembly=HG19/GRCh37>",
    "contig.10": "<ID=11,length=135006516,assembly=HG19/GRCh37>",
    "contig.11": "<ID=12,length=133851895,assembly=HG19/GRCh37>",
    "contig.12": "<ID=13,length=115169878,assembly=HG19/GRCh37>",
    "contig.13": "<ID=14,length=107349540,assembly=HG19/GRCh37>",
    "contig.14": "<ID=15,length=102531392,assembly=HG19/GRCh37>",
    "contig.15": "<ID=16,length=90354753,assembly=HG19/GRCh37>",
    "contig.16": "<ID=17,length=81195210,assembly=HG19/GRCh37>",
    "contig.17": "<ID=18,length=78077248,assembly=HG19/GRCh37>",
    "contig.18": "<ID=19,length=59128983,assembly=HG19/GRCh37>",
    "contig.19": "<ID=20,length=63025520,assembly=HG19/GRCh37>",
    "contig.20": "<ID=21,length=48129895,assembly=HG19/GRCh37>",
    "contig.21": "<ID=22,length=51304566,assembly=HG19/GRCh37>",
    "contig.22": "<ID=X,length=155270560,assembly=HG19/GRCh37>",
    "contig.23": "<ID=Y,length=59373566,assembly=HG19/GRCh37>",
    "contig.24": "<ID=MT,length=16569,assembly=HG19/GRCh37>",
    "contig.25": "<ID=GL000207.1,length=4262,assembly=HG19/GRCh37>",
    "contig.26": "<ID=GL000226.1,length=15008,assembly=HG19/GRCh37>",
    "contig.27": "<ID=GL000229.1,length=19913,assembly=HG19/GRCh37>",
    "contig.28": "<ID=GL000231.1,length=27386,assembly=HG19/GRCh37>",
    "contig.29": "<ID=GL000210.1,length=27682,assembly=HG19/GRCh37>",
    "contig.30": "<ID=GL000239.1,length=33824,assembly=HG19/GRCh37>",
    "contig.31": "<ID=GL000235.1,length=34474,assembly=HG19/GRCh37>",
    "contig.32": "<ID=GL000201.1,length=36148,assembly=HG19/GRCh37>",
    "contig.33": "<ID=GL000247.1,length=36422,assembly=HG19/GRCh37>",
    "contig.34": "<ID=GL000245.1,length=36651,assembly=HG19/GRCh37>",
    "contig.35": "<ID=GL000197.1,length=37175,assembly=HG19/GRCh37>",
    "contig.36": "<ID=GL000203.1,length=37498,assembly=HG19/GRCh37>",
    "contig.37": "<ID=GL000246.1,length=38154,assembly=HG19/GRCh37>",
    "contig.38": "<ID=GL000249.1,length=38502,assembly=HG19/GRCh37>",
    "contig.39": "<ID=GL000196.1,length=38914,assembly=HG19/GRCh37>",
    "contig.40": "<ID=GL000248.1,length=39786,assembly=HG19/GRCh37>",
    "contig.41": "<ID=GL000244.1,length=39929,assembly=HG19/GRCh37>",
    "contig.42": "<ID=GL000238.1,length=39939,assembly=HG19/GRCh37>",
    "contig.43": "<ID=GL000202.1,length=40103,assembly=HG19/GRCh37>",
    "contig.44": "<ID=GL000234.1,length=40531,assembly=HG19/GRCh37>",
    "contig.45": "<ID=GL000232.1,length=40652,assembly=HG19/GRCh37>",
    "contig.46": "<ID=GL000206.1,length=41001,assembly=HG19/GRCh37>",
    "contig.47": "<ID=GL000240.1,length=41933,assembly=HG19/GRCh37>",
    "contig.48": "<ID=GL000236.1,length=41934,assembly=HG19/GRCh37>",
    "contig.49": "<ID=GL000241.1,length=42152,assembly=HG19/GRCh37>",
    "contig.50": "<ID=GL000243.1,length=43341,assembly=HG19/GRCh37>",
    "contig.51": "<ID=GL000242.1,length=43523,assembly=HG19/GRCh37>",
    "contig.52": "<ID=GL000230.1,length=43691,assembly=HG19/GRCh37>",
    "contig.53": "<ID=GL000237.1,length=45867,assembly=HG19/GRCh37>",
    "contig.54": "<ID=GL000233.1,length=45941,assembly=HG19/GRCh37>",
    "contig.55": "<ID=GL000204.1,length=81310,assembly=HG19/GRCh37>",
    "contig.56": "<ID=GL000198.1,length=90085,assembly=HG19/GRCh37>",
    "contig.57": "<ID=GL000208.1,length=92689,assembly=HG19/GRCh37>",
    "contig.58": "<ID=GL000191.1,length=106433,assembly=HG19/GRCh37>",
    "contig.59": "<ID=GL000227.1,length=128374,assembly=HG19/GRCh37>",
    "contig.60": "<ID=GL000228.1,length=129120,assembly=HG19/GRCh37>",
    "contig.61": "<ID=GL000214.1,length=137718,assembly=HG19/GRCh37>",
    "contig.62": "<ID=GL000221.1,length=155397,assembly=HG19/GRCh37>",
    "contig.63": "<ID=GL000209.1,length=159169,assembly=HG19/GRCh37>",
    "contig.64": "<ID=GL000218.1,length=161147,assembly=HG19/GRCh37>",
    "contig.65": "<ID=GL000220.1,length=161802,assembly=HG19/GRCh37>",
    "contig.66": "<ID=GL000213.1,length=164239,assembly=HG19/GRCh37>",
    "contig.67": "<ID=GL000211.1,length=166566,assembly=HG19/GRCh37>",
    "contig.68": "<ID=GL000199.1,length=169874,assembly=HG19/GRCh37>",
    "contig.69": "<ID=GL000217.1,length=172149,assembly=HG19/GRCh37>",
    "contig.70": "<ID=GL000216.1,length=172294,assembly=HG19/GRCh37>",
    "contig.71": "<ID=GL000215.1,length=172545,assembly=HG19/GRCh37>",
    "contig.72": "<ID=GL000205.1,length=174588,assembly=HG19/GRCh37>",
    "contig.73": "<ID=GL000219.1,length=179198,assembly=HG19/GRCh37>",
    "contig.74": "<ID=GL000224.1,length=179693,assembly=HG19/GRCh37>",
    "contig.75": "<ID=GL000223.1,length=180455,assembly=HG19/GRCh37>",
    "contig.76": "<ID=GL000195.1,length=182896,assembly=HG19/GRCh37>",
    "contig.77": "<ID=GL000212.1,length=186858,assembly=HG19/GRCh37>",
    "contig.78": "<ID=GL000222.1,length=186861,assembly=HG19/GRCh37>",
    "contig.79": "<ID=GL000200.1,length=187035,assembly=HG19/GRCh37>",
    "contig.80": "<ID=GL000193.1,length=189789,assembly=HG19/GRCh37>",
    "contig.81": "<ID=GL000194.1,length=191469,assembly=HG19/GRCh37>",
    "contig.82": "<ID=GL000225.1,length=211173,assembly=HG19/GRCh37>",
    "contig.83": "<ID=GL000192.1,length=547496,assembly=HG19/GRCh37>",
    "gwas_harmonisation_command": "--json /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/PROT-a-1361_data.json --ref /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/QC/genomes/b37/human_g1k_v37.fasta; 1.1.1",
    "file_date": "2019-10-28T01:25:57.418438",
    "bcftools_annotateVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
    "bcftools_annotateCommand": "annotate -a /mnt/storage/home/gh13047/mr-eve/vcf-reference-datasets/dbsnp/dbsnp.v153.b37.vcf.gz -c ID -o /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/PROT-a-1361.vcf.gz -O z /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/PROT-a-1361_data.vcf.gz; Date=Mon Oct 28 01:55:29 2019",
    "bcftools_viewVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
    "bcftools_viewCommand": "view -h /mnt/storage/private/mrcieu/research/scratch/IGD/data/public/prot-a-1361/prot-a-1361.vcf.gz; Date=Sun May 10 06:42:10 2020"
}

LDSC

*********************************************************************
* LD Score Regression (LDSC)
* Version 1.0.1
* (C) 2014-2019 Brendan Bulik-Sullivan and Hilary Finucane
* Broad Institute of MIT and Harvard / MIT Department of Mathematics
* GNU General Public License v3
*********************************************************************
Call: 
./ldsc.py \
--h2 /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/PROT-a-1361.vcf.gz \
--ref-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/ \
--out /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/ldsc.txt \
--w-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/ 

Beginning analysis at Mon Oct 28 20:54:11 2019
Reading summary statistics from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/sun/processed/PROT-a-1361/PROT-a-1361.vcf.gz ...
Read summary statistics for 10265284 SNPs.
Dropped 20 SNPs with duplicated rs numbers.
Reading reference panel LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read reference panel LD Scores for 1290028 SNPs.
Removing partitioned LD Scores with zero variance.
Reading regression weight LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read regression weight LD Scores for 1290028 SNPs.
After merging with reference panel LD, 1280408 SNPs remain.
After merging with regression SNP LD, 1280408 SNPs remain.
Using two-step estimator with cutoff at 30.
Total Observed scale h2: 0.107 (0.1258)
Lambda GC: 1.0049
Mean Chi^2: 1.0135
Intercept: 1.0066 (0.0065)
Ratio: 0.4901 (0.4825)
Analysis finished at Mon Oct 28 20:55:42 2019
Total time elapsed: 1.0m:30.1s

QC metrics

Metrics

{
    "af_correlation": 0.9467,
    "inflation_factor": 0.9945,
    "mean_EFFECT": -0.0001,
    "n": "-Inf",
    "n_snps": 10265284,
    "n_clumped_hits": 1,
    "n_p_sig": 168,
    "n_mono": 0,
    "n_ns": 884453,
    "n_mac": 0,
    "is_snpid_unique": false,
    "n_miss_EFFECT": 0,
    "n_miss_SE": 0,
    "n_miss_PVAL": 0,
    "n_miss_AF": 277,
    "n_miss_AF_reference": 477442,
    "n_est": "NA",
    "ratio_se_n": "NA",
    "mean_diff": "NaN",
    "ratio_diff": "NaN",
    "sd_y_est1": "NaN",
    "sd_y_est2": "NA",
    "r2_sum1": 0,
    "r2_sum2": 0,
    "r2_sum3": 0,
    "r2_sum4": 0,
    "ldsc_nsnp_merge_refpanel_ld": 1280408,
    "ldsc_nsnp_merge_regression_ld": 1280408,
    "ldsc_observed_scale_h2_beta": 0.107,
    "ldsc_observed_scale_h2_se": 0.1258,
    "ldsc_intercept_beta": 1.0066,
    "ldsc_intercept_se": 0.0065,
    "ldsc_lambda_gc": 1.0049,
    "ldsc_mean_chisq": 1.0135,
    "ldsc_ratio": 0.4889
}

Flags

name	value
af_correlation	FALSE
inflation_factor	FALSE
n	TRUE
is_snpid_non_unique	TRUE
mean_EFFECT_nonfinite	FALSE
mean_EFFECT_05	FALSE
mean_EFFECT_01	FALSE
mean_chisq	FALSE
n_p_sig	FALSE
miss_EFFECT	FALSE
miss_SE	FALSE
miss_PVAL	FALSE
ldsc_ratio	FALSE
ldsc_intercept_beta	FALSE
n_clumped_hits	FALSE
r2_sum1	FALSE
r2_sum2	FALSE
r2_sum3	FALSE
r2_sum4	FALSE

Definitions

General metrics

af_correlation: Correlation coefficient between AF and AF_reference.
inflation_factor (lambda): Genomic inflation factor.
mean_EFFECT: Mean of EFFECT size.
n: Maximum value of reported sample size across all SNPs, \(n\).
n_clumped_hits: Number of clumped hits.
n_snps: Number of SNPs
n_p_sig: Number of SNPs with pvalue below 5e-8.
n_mono: Number of monomorphic (MAF == 1 or MAF == 0) SNPs.
n_ns: Number of SNPs with nonsense values:
- alleles other than A, C, G or T.
- P-values < 0 or > 1.
- negative or infinite standard errors (<= 0 or = Infinity).
- infinite beta estimates or allele frequencies < 0 or > 1.
n_mac: Number of cases where MAC (\(2 \times N \times MAF\)) is less than 6.
is_snpid_unique: true if the combination of ID REF ALT is unique and therefore no duplication in snpid.
n_miss_<*>: Number of NA observations for <*> column.

se_n metrics

n_est: Estimated sample size value, \(\widehat{n}\).
ratio_se_n: \(\texttt{ratio_se_n} = \frac{\sqrt{\widehat{n}}}{\sqrt{n}}\). We expect ratio_se_n to be 1. When it is not 1, it implies that the trait did not have a variance of 1, the reported sample size is wrong, or that the SNP-level effective sample sizes differ markedly from the reported sample size.
mean_diff: \(\texttt{mean_diff} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta_j}{\texttt{n_snps}}\), mean difference between the standardised beta, predicted from P-values, and the observed beta. The difference should be very close to zero if trait has a variance of 1.
- \(\widehat{\beta_j^{std}} = \sqrt{\frac{{z}_j^2 / ({z}_j^2 + n -2)}{2 \times {MAF}_j \times (1 - {MAF}_j)}} \times sign({z}_j)\),
- \({z}_j = \frac{\beta_j}{{se}_j}\),
- and \(\beta_j\) is the reported effect size.
ratio_diff: \(\texttt{ratio_diff} = |\frac{\texttt{mean_diff}}{\texttt{mean_diff2}}|\), absolute ratio between the mean of diff and the mean of diff2 (expected difference between the standardised beta predicted from P-values, and the standardised beta derived from the observed beta divided by the predicted SD; NOT reported). The ratio should be close to 1. If different from 1, then implies that the betas are not in a standard deviation scale.
- \(\texttt{mean_diff2} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta^{\prime}_j}{\texttt{n_snps}}\)
- \(\beta^{\prime}_j = \frac{\beta_j}{\widehat{\texttt{sd2}}_{y}}\)
sd_y_est1: The standard deviation for the trait inferred from the reported sample size, median standard errors for the SNP-trait assocations and SNP variances.
- \(\widehat{\texttt{sd1}}_{y} = \frac{\sqrt{n} \times median({se}_j)}{C}\),
- \(C = median(\frac{1}{\sqrt{2 \times {MAF}_j \times (1 - {MAF}_j)}})\),
- and \({se}_j\) is the reported standard error.
sd_y_est2: The standard deviation for the trait inferred from the reported sample size, Z statistics for the SNP-trait effects (beta/se) and allele frequency.
- \(\widehat{\texttt{sd2}}_{y} = median(\widehat{sd_j})\),
- \(\widehat{sd_j} = \frac{\beta_j}{\widehat{\beta_j^{std}}}\),

r2 metrics

Sum of variance explained, calculated from the clumped top hits sample.

r2_sum<*>: r2 statistics under various assumptions
- 1: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var1}}}\), \(\texttt{var1} = 1\).
- 2: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var2}}}\), \(\texttt{var2} = {\widehat{\texttt{sd1}}_{y}}^2\),
- 3: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var3}}}\), \(\texttt{var3} = {\widehat{\texttt{sd2}}_{y}}^2\),
- 4: \(r^2 = \sum_j{\frac{F_j}{F_j + n - 2}}\), \(F = \frac{\beta_j^2}{{se}_j^2}\).

LDSC metrics

Metrics from LD regression

ldsc_nsnp_merge_refpanel_ld: Number of remaining SNPs after merging with reference panel LD.
ldsc_nsnp_merge_regression_ld: Number of remaining SNPs after merging with regression SNP LD.
ldsc_observed_scale_h2_{beta,se} Coefficient value and SE for total observed scale h2.
ldsc_intercept_{beta,se}: Coefficient value and SE for intercept. Intercept is expected to be 1.
ldsc_lambda_gc: Lambda GC statistics.
ldsc_mean_chisq: Mean \(\chi^2\) statistics.
ldsc_ratio: \(\frac{\texttt{ldsc_intercept_beta} - 1}{\texttt{ldsc_mean_chisq} - 1}\), the proportion of the inflation in the mean \(\chi^2\) that the LD Score regression intercepts ascribes to causes other than polygenic heritability. The value of ratio should be close to zero, though in practice values of 0.1-0.2 are not uncommon, probably due to sample/reference LD Score mismatch or model misspecification (e.g., low LD variants have slightly higher \(h^2\) per SNP).

Flags

When a metric needs attention, the flag should return TRUE.

af_correlation: abs(af_correlation) < 0.7.
inflation_factor: inflation_factor > 1.2.
n: n (max reported sample size) < 10000.
is_snpid_non_unique: NOT is_snpid_unique.
mean_EFFECT_nonfinite: mean(EFFECT) is NA, NaN, or Inf.
mean_EFFECT_05: abs(mean(EFFECT)) > 0.5.
mean_EFFECT_01: abs(mean(EFFECT)) > 0.1.
mean_chisq: ldsc_mean_chisq > 1.3 or ldsc_mean_chisq < 0.7.
n_p_sig: n_p_sig > 1000.
miss_<*>: n_miss_<*> / n_snps > 0.01.
ldsc_ratio: ldsc_ratio > 0.5
ldsc_intercept_beta: ldsc_intercept_beta > 1.5
n_clumped_hits: n_clumped_hits > 1000
r2_sum<*>: r2_sum<*> > 0.5

Plots

Manhattan plot
- Red line: \(-log_{10}^{5 \times 10^{-8}}\)
- Blue line: \(-log_{10}^{5 \times 10^{-5}}\)
QQ plot
AF plot
P-Z plot
beta_std plot: Scatter plot between \(\widehat{\beta_j^{std}}\) and \(\beta_j\)

Diagnostics

Details

Summary stats

skim_type	skim_variable	n_missing	complete_rate	character.min	character.max	character.empty	character.n_unique	character.whitespace	logical.mean	logical.count	numeric.mean	numeric.sd	numeric.p0	numeric.p25	numeric.p50	numeric.p75	numeric.p100	numeric.hist
character	ID	0	1.0000000	3	58	0	10265275	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
character	REF	0	1.0000000	1	97	0	38413	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
character	ALT	0	1.0000000	1	412	0	24018	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
logical	N	10265284	0.0000000	NA	NA	NA	NA	NA	NaN	:	NA	NA	NA	NA	NA	NA	NA	NA
numeric	CHROM	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	8.643747e+00	5.756573e+00	1.00000	4.000000e+00	8.000000e+00	1.300000e+01	2.200000e+01	▇▅▅▂▂
numeric	POS	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	7.877894e+07	5.630825e+07	302.00000	3.256329e+07	6.917355e+07	1.143686e+08	2.492405e+08	▇▆▅▂▁
numeric	EFFECT	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	-7.000000e-05	7.312780e-02	-0.90500	-3.000000e-02	-2.000000e-04	2.970000e-02	8.714000e-01	▁▁▇▁▁
numeric	SE	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	5.959380e-02	4.190000e-02	0.02390	2.810000e-02	4.050000e-02	7.890000e-02	2.524000e-01	▇▂▁▁▁
numeric	PVAL	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	4.991683e-01	2.894856e-01	0.00000	2.454709e-01	5.011872e-01	7.585776e-01	1.000000e+00	▇▇▇▇▇
numeric	PVAL_ztest	0	1.0000000	NA	NA	NA	NA	NA	NA	NA	4.991354e-01	2.894158e-01	0.00000	2.480394e-01	4.995598e-01	7.499682e-01	1.000000e+00	▇▇▇▇▇
numeric	AF	277	0.9999730	NA	NA	NA	NA	NA	NA	NA	2.512646e-01	2.751608e-01	0.00242	2.907000e-02	1.321000e-01	4.053500e-01	9.988300e-01	▇▂▂▁▁
numeric	AF_reference	477442	0.9534896	NA	NA	NA	NA	NA	NA	NA	2.332106e-01	2.519924e-01	0.00000	2.535940e-02	1.361820e-01	3.694090e-01	1.000000e+00	▇▂▂▁▁

Head and tail

CHROM	POS	ID	REF	ALT	EFFECT	SE	PVAL	PVAL_ztest	AF	AF_reference	N
1	10177	rs367896724	AC	A	0.0024	0.0299	0.9332541	0.9360245	0.62806	NA	NA
1	10616	rs376342519	C	CCGCCGTTGCAAAGGCGCGCCG	-0.1551	0.1646	0.3467369	0.3460471	0.00751	NA	NA
1	11008	rs575272151	C	G	0.0498	0.0518	0.3388442	0.3363561	0.08306	0.0880591	NA
1	13273	rs531730856	G	C	-0.0649	0.0434	0.1348960	0.1348122	0.13251	0.0950479	NA
1	13483	rs554760071	G	C	-0.1054	0.1959	0.5888437	0.5905566	0.00504	0.0019968	NA
1	14604	rs541940975	A	G	0.0255	0.0370	0.4897788	0.4907042	0.18665	0.1475640	NA
1	14933	rs199856693	G	A	-0.0020	0.0677	0.9772370	0.9764322	0.04746	0.0283546	NA
1	18849	rs533090414	C	G	0.0642	0.0797	0.4168694	0.4205193	0.96874	0.9518770	NA
1	30923	rs806731	G	T	0.0661	0.0463	0.1548820	0.1533938	0.89387	0.8724040	NA
1	47159	rs540662756	T	C	-0.0117	0.0594	0.8511380	0.8438513	0.06190	0.0273562	NA

CHROM	POS	ID	REF	ALT	EFFECT	SE	PVAL	PVAL_ztest	AF	AF_reference	N
22	51237063	rs3896457	T	C	0.0439	0.0268	0.1023291	0.1014092	0.28870	0.2050720	NA
22	51237364	rs200607599	A	G	0.0868	0.1161	0.4570882	0.4546825	0.01151	0.0187700	NA
22	51237712	rs370652263	G	A	-0.0355	0.0513	0.4897788	0.4889324	0.06180	0.0690895	NA
22	51238394	rs149712012	C	T	-0.3040	0.1834	0.0977237	0.0974025	0.00454	0.0033946	NA
22	51239281	rs8138215	G	C	-0.0651	0.2011	0.7413102	0.7461504	0.00379	0.0111821	NA
22	51239296	rs8137179	T	C	-0.0651	0.2011	0.7413102	0.7461504	0.00379	0.0111821	NA
22	51239304	rs8142977	C	T	-0.0651	0.2011	0.7413102	0.7461504	0.00379	0.0111821	NA
22	51239794	rs561893765	C	A	0.0221	0.2141	0.9120110	0.9177862	0.00333	0.0299521	NA
22	51241386	rs568168135	C	G	-0.0073	0.1654	0.9549930	0.9647965	0.00560	0.0139776	NA
22	51244237	rs575160859	C	T	-0.1484	0.1168	0.2041738	0.2038895	0.01136	0.0037939	NA

bcf preview

1   10177   rs367896724 AC  A   .   PASS    AF=0.62806  ES:SE:LP:AF:ID  0.0024:0.0299:0.0300001:0.62806:rs367896724
1   10616   rs376342519 C   CCGCCGTTGCAAAGGCGCGCCG  .   PASS    AF=0.00751  ES:SE:LP:AF:ID  -0.1551:0.1646:0.46:0.00751:rs376342519
1   11008   rs575272151 C   G   .   PASS    AF=0.08306  ES:SE:LP:AF:ID  0.0498:0.0518:0.47:0.08306:rs575272151
1   13273   rs531730856 G   C   .   PASS    AF=0.13251  ES:SE:LP:AF:ID  -0.0649:0.0434:0.870001:0.13251:rs531730856
1   13483   rs554760071 G   C   .   PASS    AF=0.00504  ES:SE:LP:AF:ID  -0.1054:0.1959:0.23:0.00504:rs554760071
1   14604   rs541940975 A   G   .   PASS    AF=0.18665  ES:SE:LP:AF:ID  0.0255:0.037:0.31:0.18665:rs541940975
1   14933   rs199856693 G   A   .   PASS    AF=0.04746  ES:SE:LP:AF:ID  -0.002:0.0677:0.0100001:0.04746:rs199856693
1   18849   rs533090414 C   G   .   PASS    AF=0.96874  ES:SE:LP:AF:ID  0.0642:0.0797:0.38:0.96874:rs533090414
1   30923   rs806731    G   T   .   PASS    AF=0.89387  ES:SE:LP:AF:ID  0.0661:0.0463:0.809999:0.89387:rs806731
1   47159   rs540662756 T   C   .   PASS    AF=0.0619   ES:SE:LP:AF:ID  -0.0117:0.0594:0.07:0.0619:rs540662756
1   49554   rs539322794 A   G   .   PASS    AF=0.08749  ES:SE:LP:AF:ID  -0.0448:0.0524:0.41:0.08749:rs539322794
1   54712   rs568927205 TTTTC   T   .   PASS    AF=0.43775  ES:SE:LP:AF:ID  0.0152:0.0283:0.23:0.43775:rs568927205
1   54945   rs569799965 C   A   .   PASS    AF=0.00751  ES:SE:LP:AF:ID  -0.0452:0.1699:0.1:0.00751:rs569799965
1   55249   rs200769871 C   CTATGG  .   PASS    AF=0.01031  ES:SE:LP:AF:ID  0.0305:0.142:0.0799999:0.01031:rs200769871
1   59040   rs62637815  T   C   .   PASS    AF=0.08548  ES:SE:LP:AF:ID  -0.0004:0.0528:-0:0.08548:rs62637815
1   60351   rs62637817  A   G   .   PASS    AF=0.08009  ES:SE:LP:AF:ID  0.0072:0.0542:0.05:0.08009:rs62637817
1   61208   rs527362206 T   C   .   PASS    AF=0.00728  ES:SE:LP:AF:ID  -0.0548:0.1709:0.13:0.00728:rs527362206
1   61743   rs184286948 G   C   .   PASS    AF=0.00759  ES:SE:LP:AF:ID  -0.1038:0.1685:0.27:0.00759:rs184286948
1   63093   rs200092917 G   A   .   PASS    AF=0.02888  ES:SE:LP:AF:ID  -0.0204:0.0875:0.0899997:0.02888:rs200092917
1   63671   rs80011619  G   A   .   PASS    AF=0.15883  ES:SE:LP:AF:ID  -0.0289:0.04:0.33:0.15883:rs80011619
1   64649   rs181431124 A   C   .   PASS    AF=0.02531  ES:SE:LP:AF:ID  0.0544:0.0932:0.25:0.02531:rs181431124
1   64931   rs62639104  G   A   .   PASS    AF=0.07866  ES:SE:LP:AF:ID  -0.0049:0.0543:0.0300001:0.07866:rs62639104
1   66219   rs181028663 A   T   .   PASS    AF=0.01917  ES:SE:LP:AF:ID  0.14:0.1018:0.770001:0.01917:rs181028663
1   67107   rs545950684 A   G   .   PASS    AF=0.00703  ES:SE:LP:AF:ID  -0.0784:0.1734:0.19:0.00703:rs545950684
1   68082   rs367789441 T   C   .   PASS    AF=0.07119  ES:SE:LP:AF:ID  -0.157:0.0572:2.21:0.07119:rs367789441
1   69428   rs140739101 T   G   .   PASS    AF=0.03289  ES:SE:LP:AF:ID  -0.021:0.081:0.1:0.03289:rs140739101
1   69761   rs200505207 A   T   .   PASS    AF=0.07372  ES:SE:LP:AF:ID  -0.0987:0.0566:1.09:0.07372:rs200505207
1   69897   rs200676709 T   C   .   PASS    AF=0.71804  ES:SE:LP:AF:ID  0.0216:0.0316:0.31:0.71804:rs200676709
1   77866   rs563593912 C   T   .   PASS    AF=0.0757   ES:SE:LP:AF:ID  -0.0299:0.0548:0.23:0.0757:rs563593912
1   81587   rs536406113 C   T   .   PASS    AF=0.06385  ES:SE:LP:AF:ID  -0.1394:0.0596:1.71:0.06385:rs536406113
1   82163   rs139113303 G   A   .   PASS    AF=0.07738  ES:SE:LP:AF:ID  -0.0037:0.0529:0.0199998:0.07738:rs139113303
1   82609   rs149189449 C   G   .   PASS    AF=0.07539  ES:SE:LP:AF:ID  0.0005:0.0537:-0:0.07539:rs149189449
1   86065   rs116504101 G   C   .   PASS    AF=0.0764   ES:SE:LP:AF:ID  -0.0027:0.0536:0.0199998:0.0764:rs116504101
1   87409   rs139490478 C   T   .   PASS    AF=0.07661  ES:SE:LP:AF:ID  -0.0148:0.0535:0.11:0.07661:rs139490478
1   88169   rs940550    C   T   .   PASS    AF=0.20467  ES:SE:LP:AF:ID  -0.0674:0.0361:1.21:0.20467:rs940550
1   88172   rs940551    G   A   .   PASS    AF=0.07528  ES:SE:LP:AF:ID  -0.0913:0.0553:1.01:0.07528:rs940551
1   88177   rs143215837 G   C   .   PASS    AF=0.07235  ES:SE:LP:AF:ID  -0.0884:0.0564:0.929999:0.07235:rs143215837
1   88316   rs113759966 G   A   .   PASS    AF=0.07124  ES:SE:LP:AF:ID  -0.0725:0.0571:0.69:0.07124:rs113759966
1   88338   rs55700207  G   A   .   PASS    AF=0.07793  ES:SE:LP:AF:ID  -0.0358:0.0534:0.3:0.07793:rs55700207
1   88710   rs186575039 C   G   .   PASS    AF=0.07789  ES:SE:LP:AF:ID  -0.0082:0.053:0.0599998:0.07789:rs186575039
1   89599   rs375955515 A   T   .   PASS    AF=0.07642  ES:SE:LP:AF:ID  -0.0123:0.0532:0.0899997:0.07642:rs375955515
1   91190   rs143856811 G   A   .   PASS    AF=0.08117  ES:SE:LP:AF:ID  -0.0118:0.0517:0.0899997:0.08117:rs143856811
1   91340   rs376250562 C   G   .   PASS    AF=0.01521  ES:SE:LP:AF:ID  0.0388:0.1199:0.13:0.01521:rs376250562
1   91358   rs370712517 G   T   .   PASS    AF=0.01478  ES:SE:LP:AF:ID  0.0568:0.1208:0.19:0.01478:rs370712517
1   91421   rs28619159  T   C   .   PASS    AF=0.01861  ES:SE:LP:AF:ID  0.0122:0.1035:0.0399999:0.01861:rs28619159
1   91515   rs376723915 A   C   .   PASS    AF=0.54508  ES:SE:LP:AF:ID  -0.0042:0.029:0.05:0.54508:rs376723915
1   91536   rs6702460   G   T   .   PASS    AF=0.56854  ES:SE:LP:AF:ID  0.0094:0.0291:0.13:0.56854:rs6702460
1   92858   rs147061536 G   T   .   PASS    AF=0.22951  ES:SE:LP:AF:ID  0.0802:0.0348:1.67:0.22951:rs147061536
1   99687   rs139153227 C   T   .   PASS    AF=0.06852  ES:SE:LP:AF:ID  -0.0846:0.0578:0.849999:0.06852:rs139153227
1   104281  rs576842010 T   C   .   PASS    AF=0.04001  ES:SE:LP:AF:ID  0.1482:0.0748:1.32:0.04001:rs576842010