Summary

Summary {data-width=650}

Manhattan plot

manhattan_plot

QQ plot

qq_plot

AF plot

af_plot

P-Z plot

pz_plot

beta_std plot

beta_std_plot

Metadata

{
    "fileformat": "VCFv4.2",
    "FILTER": "<ID=PASS,Description=\"All filters passed\">",
    "INFO": "<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency\">",
    "FORMAT": "<ID=ES,Number=A,Type=Float,Description=\"Effect size estimate relative to the alternative allele\">",
    "FORMAT.1": "<ID=SE,Number=A,Type=Float,Description=\"Standard error of effect size estimate\">",
    "FORMAT.2": "<ID=LP,Number=A,Type=Float,Description=\"-log10 p-value for effect estimate\">",
    "FORMAT.3": "<ID=AF,Number=A,Type=Float,Description=\"Alternate allele frequency in the association study\">",
    "FORMAT.4": "<ID=SS,Number=A,Type=Float,Description=\"Sample size used to estimate genetic effect\">",
    "FORMAT.5": "<ID=EZ,Number=A,Type=Float,Description=\"Z-score provided if it was used to derive the EFFECT and SE fields\">",
    "FORMAT.6": "<ID=SI,Number=A,Type=Float,Description=\"Accuracy score of summary data imputation\">",
    "FORMAT.7": "<ID=NC,Number=A,Type=Float,Description=\"Number of cases used to estimate genetic effect\">",
    "FORMAT.8": "<ID=ID,Number=1,Type=String,Description=\"Study variant identifier\">",
    "META": "<ID=TotalVariants,Number=1,Type=Integer,Description=\"Total number of variants in input\">",
    "META.1": "<ID=VariantsNotRead,Number=1,Type=Integer,Description=\"Number of variants that could not be read\">",
    "META.2": "<ID=HarmonisedVariants,Number=1,Type=Integer,Description=\"Total number of harmonised variants\">",
    "META.3": "<ID=VariantsNotHarmonised,Number=1,Type=Integer,Description=\"Total number of variants that could not be harmonised\">",
    "META.4": "<ID=SwitchedAlleles,Number=1,Type=Integer,Description=\"Total number of variants strand switched\">",
    "META.5": "<ID=TotalControls,Number=1,Type=Integer,Description=\"Total number of controls in the association study\">",
    "META.6": "<ID=TotalCases,Number=1,Type=Integer,Description=\"Total number of cases in the association study\">",
    "META.7": "<ID=StudyType,Number=1,Type=String,Description=\"Type of GWAS study [Continuous or CaseControl]\">",
    "SAMPLE": "<ID=ieu-b-5071,TotalVariants=13525533,VariantsNotRead=0,HarmonisedVariants=13525533,VariantsNotHarmonised=0,SwitchedAlleles=12749018,NormalisedVariants=0,StudyType=Continuous>",
    "contig": "<ID=1,length=249250621,assembly=HG19/GRCh37>",
    "contig.1": "<ID=2,length=243199373,assembly=HG19/GRCh37>",
    "contig.2": "<ID=3,length=198022430,assembly=HG19/GRCh37>",
    "contig.3": "<ID=4,length=191154276,assembly=HG19/GRCh37>",
    "contig.4": "<ID=5,length=180915260,assembly=HG19/GRCh37>",
    "contig.5": "<ID=6,length=171115067,assembly=HG19/GRCh37>",
    "contig.6": "<ID=7,length=159138663,assembly=HG19/GRCh37>",
    "contig.7": "<ID=8,length=146364022,assembly=HG19/GRCh37>",
    "contig.8": "<ID=9,length=141213431,assembly=HG19/GRCh37>",
    "contig.9": "<ID=10,length=135534747,assembly=HG19/GRCh37>",
    "contig.10": "<ID=11,length=135006516,assembly=HG19/GRCh37>",
    "contig.11": "<ID=12,length=133851895,assembly=HG19/GRCh37>",
    "contig.12": "<ID=13,length=115169878,assembly=HG19/GRCh37>",
    "contig.13": "<ID=14,length=107349540,assembly=HG19/GRCh37>",
    "contig.14": "<ID=15,length=102531392,assembly=HG19/GRCh37>",
    "contig.15": "<ID=16,length=90354753,assembly=HG19/GRCh37>",
    "contig.16": "<ID=17,length=81195210,assembly=HG19/GRCh37>",
    "contig.17": "<ID=18,length=78077248,assembly=HG19/GRCh37>",
    "contig.18": "<ID=19,length=59128983,assembly=HG19/GRCh37>",
    "contig.19": "<ID=20,length=63025520,assembly=HG19/GRCh37>",
    "contig.20": "<ID=21,length=48129895,assembly=HG19/GRCh37>",
    "contig.21": "<ID=22,length=51304566,assembly=HG19/GRCh37>",
    "contig.22": "<ID=X,length=155270560,assembly=HG19/GRCh37>",
    "contig.23": "<ID=Y,length=59373566,assembly=HG19/GRCh37>",
    "contig.24": "<ID=MT,length=16569,assembly=HG19/GRCh37>",
    "contig.25": "<ID=GL000207.1,length=4262,assembly=HG19/GRCh37>",
    "contig.26": "<ID=GL000226.1,length=15008,assembly=HG19/GRCh37>",
    "contig.27": "<ID=GL000229.1,length=19913,assembly=HG19/GRCh37>",
    "contig.28": "<ID=GL000231.1,length=27386,assembly=HG19/GRCh37>",
    "contig.29": "<ID=GL000210.1,length=27682,assembly=HG19/GRCh37>",
    "contig.30": "<ID=GL000239.1,length=33824,assembly=HG19/GRCh37>",
    "contig.31": "<ID=GL000235.1,length=34474,assembly=HG19/GRCh37>",
    "contig.32": "<ID=GL000201.1,length=36148,assembly=HG19/GRCh37>",
    "contig.33": "<ID=GL000247.1,length=36422,assembly=HG19/GRCh37>",
    "contig.34": "<ID=GL000245.1,length=36651,assembly=HG19/GRCh37>",
    "contig.35": "<ID=GL000197.1,length=37175,assembly=HG19/GRCh37>",
    "contig.36": "<ID=GL000203.1,length=37498,assembly=HG19/GRCh37>",
    "contig.37": "<ID=GL000246.1,length=38154,assembly=HG19/GRCh37>",
    "contig.38": "<ID=GL000249.1,length=38502,assembly=HG19/GRCh37>",
    "contig.39": "<ID=GL000196.1,length=38914,assembly=HG19/GRCh37>",
    "contig.40": "<ID=GL000248.1,length=39786,assembly=HG19/GRCh37>",
    "contig.41": "<ID=GL000244.1,length=39929,assembly=HG19/GRCh37>",
    "contig.42": "<ID=GL000238.1,length=39939,assembly=HG19/GRCh37>",
    "contig.43": "<ID=GL000202.1,length=40103,assembly=HG19/GRCh37>",
    "contig.44": "<ID=GL000234.1,length=40531,assembly=HG19/GRCh37>",
    "contig.45": "<ID=GL000232.1,length=40652,assembly=HG19/GRCh37>",
    "contig.46": "<ID=GL000206.1,length=41001,assembly=HG19/GRCh37>",
    "contig.47": "<ID=GL000240.1,length=41933,assembly=HG19/GRCh37>",
    "contig.48": "<ID=GL000236.1,length=41934,assembly=HG19/GRCh37>",
    "contig.49": "<ID=GL000241.1,length=42152,assembly=HG19/GRCh37>",
    "contig.50": "<ID=GL000243.1,length=43341,assembly=HG19/GRCh37>",
    "contig.51": "<ID=GL000242.1,length=43523,assembly=HG19/GRCh37>",
    "contig.52": "<ID=GL000230.1,length=43691,assembly=HG19/GRCh37>",
    "contig.53": "<ID=GL000237.1,length=45867,assembly=HG19/GRCh37>",
    "contig.54": "<ID=GL000233.1,length=45941,assembly=HG19/GRCh37>",
    "contig.55": "<ID=GL000204.1,length=81310,assembly=HG19/GRCh37>",
    "contig.56": "<ID=GL000198.1,length=90085,assembly=HG19/GRCh37>",
    "contig.57": "<ID=GL000208.1,length=92689,assembly=HG19/GRCh37>",
    "contig.58": "<ID=GL000191.1,length=106433,assembly=HG19/GRCh37>",
    "contig.59": "<ID=GL000227.1,length=128374,assembly=HG19/GRCh37>",
    "contig.60": "<ID=GL000228.1,length=129120,assembly=HG19/GRCh37>",
    "contig.61": "<ID=GL000214.1,length=137718,assembly=HG19/GRCh37>",
    "contig.62": "<ID=GL000221.1,length=155397,assembly=HG19/GRCh37>",
    "contig.63": "<ID=GL000209.1,length=159169,assembly=HG19/GRCh37>",
    "contig.64": "<ID=GL000218.1,length=161147,assembly=HG19/GRCh37>",
    "contig.65": "<ID=GL000220.1,length=161802,assembly=HG19/GRCh37>",
    "contig.66": "<ID=GL000213.1,length=164239,assembly=HG19/GRCh37>",
    "contig.67": "<ID=GL000211.1,length=166566,assembly=HG19/GRCh37>",
    "contig.68": "<ID=GL000199.1,length=169874,assembly=HG19/GRCh37>",
    "contig.69": "<ID=GL000217.1,length=172149,assembly=HG19/GRCh37>",
    "contig.70": "<ID=GL000216.1,length=172294,assembly=HG19/GRCh37>",
    "contig.71": "<ID=GL000215.1,length=172545,assembly=HG19/GRCh37>",
    "contig.72": "<ID=GL000205.1,length=174588,assembly=HG19/GRCh37>",
    "contig.73": "<ID=GL000219.1,length=179198,assembly=HG19/GRCh37>",
    "contig.74": "<ID=GL000224.1,length=179693,assembly=HG19/GRCh37>",
    "contig.75": "<ID=GL000223.1,length=180455,assembly=HG19/GRCh37>",
    "contig.76": "<ID=GL000195.1,length=182896,assembly=HG19/GRCh37>",
    "contig.77": "<ID=GL000212.1,length=186858,assembly=HG19/GRCh37>",
    "contig.78": "<ID=GL000222.1,length=186861,assembly=HG19/GRCh37>",
    "contig.79": "<ID=GL000200.1,length=187035,assembly=HG19/GRCh37>",
    "contig.80": "<ID=GL000193.1,length=189789,assembly=HG19/GRCh37>",
    "contig.81": "<ID=GL000194.1,length=191469,assembly=HG19/GRCh37>",
    "contig.82": "<ID=GL000225.1,length=211173,assembly=HG19/GRCh37>",
    "contig.83": "<ID=GL000192.1,length=547496,assembly=HG19/GRCh37>",
    "Gwas2VCF_command": "--data /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-vcf/inputs/-261022253/upload.txt.gz --id ieu-b-5071 --json /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-vcf/inputs/-261022253/ieu-b-5071_data.json --ref /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-vcf/inputs/1899004205/human_g1k_v37.fasta --dbsnp /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-vcf/inputs/-307190728/dbsnp.v153.b37.vcf.gz --out /data/igd/ieu-b-5071/ieu-b-5071.vcf.gz --alias alias.txt; 1.3.0",
    "file_date": "2022-05-15T17:35:50.851705",
    "bcftools_viewVersion": "1.9+htslib-1.9",
    "bcftools_viewCommand": "view -h /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-report/inputs/-261022253/ieu-b-5071.vcf.gz; Date=Sun May 15 18:12:03 2022"
}

LDSC

*********************************************************************
* LD Score Regression (LDSC)
* Version 1.0.1
* (C) 2014-2019 Brendan Bulik-Sullivan and Hilary Finucane
* Broad Institute of MIT and Harvard / MIT Department of Mathematics
* GNU General Public License v3
*********************************************************************
Call: 
./ldsc.py \
--h2 /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-ldsc/inputs/-261022253/ieu-b-5071.vcf.gz \
--ref-ld-chr /data/ref/eur_w_ld_chr/ \
--out /data/igd/ieu-b-5071/ldsc.txt \
--w-ld-chr /data/ref/eur_w_ld_chr/ 

Beginning analysis at Sun May 15 17:59:36 2022
Reading summary statistics from /data/cromwell-executions/qc/0f4c6086-f5d8-4310-9a9d-8ba6720dc8ae/call-ldsc/inputs/-261022253/ieu-b-5071.vcf.gz ...
Read summary statistics for 0 SNPs.
Reading reference panel LD Score from /data/ref/eur_w_ld_chr/[1-22] ... (ldscore_fromlist)
Read reference panel LD Scores for 1290028 SNPs.
Removing partitioned LD Scores with zero variance.
Reading regression weight LD Score from /data/ref/eur_w_ld_chr/[1-22] ... (ldscore_fromlist)
Read regression weight LD Scores for 1290028 SNPs.
Traceback (most recent call last):
  File "./ldsc/ldsc.py", line 647, in <module>
    sumstats.estimate_h2(args, log)
  File "/ldsc/ldscore/sumstats.py", line 330, in estimate_h2
    args, log, args.h2)
  File "/ldsc/ldscore/sumstats.py", line 252, in _read_ld_sumstats
    sumstats = _merge_and_log(ref_ld, sumstats, 'reference panel LD', log)
  File "/ldsc/ldscore/sumstats.py", line 238, in _merge_and_log
    raise ValueError(msg.format(N=len(sumstats), F=noun))
ValueError: After merging with reference panel LD, 0 SNPs remain.

Analysis finished at Sun May 15 18:01:02 2022
Total time elapsed: 1.0m:25.98s

QC metrics

Metrics

Metrics

{
    "af_correlation": 0.9272,
    "inflation_factor": 1.0475,
    "mean_EFFECT": "NaN",
    "n": "-Inf",
    "n_snps": 13525533,
    "n_clumped_hits": 5,
    "n_p_sig": 910,
    "n_mono": 47833,
    "n_ns": 930519,
    "n_mac": 0,
    "is_snpid_unique": false,
    "n_miss_EFFECT": 0,
    "n_miss_SE": 0,
    "n_miss_PVAL": 0,
    "n_miss_AF": 0,
    "n_miss_AF_reference": 2715836,
    "n_est": "NA",
    "ratio_se_n": "NA",
    "mean_diff": "NaN",
    "ratio_diff": "NaN",
    "sd_y_est1": "NaN",
    "sd_y_est2": "NA",
    "r2_sum1": 0,
    "r2_sum2": 0,
    "r2_sum3": 0,
    "r2_sum4": 0,
    "ldsc_nsnp_merge_refpanel_ld": 0,
    "ldsc_nsnp_merge_regression_ld": "NA",
    "ldsc_observed_scale_h2_beta": "NA",
    "ldsc_observed_scale_h2_se": "NA",
    "ldsc_intercept_beta": "NA",
    "ldsc_intercept_se": "NA",
    "ldsc_lambda_gc": "NA",
    "ldsc_mean_chisq": "NA",
    "ldsc_ratio": "NA"
}

Flags

name value
af_correlation FALSE
inflation_factor FALSE
n TRUE
is_snpid_non_unique TRUE
mean_EFFECT_nonfinite TRUE
mean_EFFECT_05 NA
mean_EFFECT_01 NA
mean_chisq NA
n_p_sig FALSE
miss_EFFECT FALSE
miss_SE FALSE
miss_PVAL FALSE
ldsc_ratio NA
ldsc_intercept_beta NA
n_clumped_hits FALSE
r2_sum1 FALSE
r2_sum2 FALSE
r2_sum3 FALSE
r2_sum4 FALSE

Definitions

General metrics

  • af_correlation: Correlation coefficient between AF and AF_reference.
  • inflation_factor (lambda): Genomic inflation factor.
  • mean_EFFECT: Mean of EFFECT size.
  • n: Maximum value of reported sample size across all SNPs, \(n\).
  • n_clumped_hits: Number of clumped hits.
  • n_snps: Number of SNPs
  • n_p_sig: Number of SNPs with pvalue below 5e-8.
  • n_mono: Number of monomorphic (MAF == 1 or MAF == 0) SNPs.
  • n_ns: Number of SNPs with nonsense values:
    • alleles other than A, C, G or T.
    • P-values < 0 or > 1.
    • negative or infinite standard errors (<= 0 or = Infinity).
    • infinite beta estimates or allele frequencies < 0 or > 1.
  • n_mac: Number of cases where MAC (\(2 \times N \times MAF\)) is less than 6.
  • is_snpid_unique: true if the combination of ID REF ALT is unique and therefore no duplication in snpid.
  • n_miss_<*>: Number of NA observations for <*> column.

se_n metrics

  • n_est: Estimated sample size value, \(\widehat{n}\).
  • ratio_se_n: \(\texttt{ratio_se_n} = \frac{\sqrt{\widehat{n}}}{\sqrt{n}}\). We expect ratio_se_n to be 1. When it is not 1, it implies that the trait did not have a variance of 1, the reported sample size is wrong, or that the SNP-level effective sample sizes differ markedly from the reported sample size.
  • mean_diff: \(\texttt{mean_diff} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta_j}{\texttt{n_snps}}\), mean difference between the standardised beta, predicted from P-values, and the observed beta. The difference should be very close to zero if trait has a variance of 1.
    • \(\widehat{\beta_j^{std}} = \sqrt{\frac{{z}_j^2 / ({z}_j^2 + n -2)}{2 \times {MAF}_j \times (1 - {MAF}_j)}} \times sign({z}_j)\),
    • \({z}_j = \frac{\beta_j}{{se}_j}\),
    • and \(\beta_j\) is the reported effect size.
  • ratio_diff: \(\texttt{ratio_diff} = |\frac{\texttt{mean_diff}}{\texttt{mean_diff2}}|\), absolute ratio between the mean of diff and the mean of diff2 (expected difference between the standardised beta predicted from P-values, and the standardised beta derived from the observed beta divided by the predicted SD; NOT reported). The ratio should be close to 1. If different from 1, then implies that the betas are not in a standard deviation scale.
    • \(\texttt{mean_diff2} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta^{\prime}_j}{\texttt{n_snps}}\)
    • \(\beta^{\prime}_j = \frac{\beta_j}{\widehat{\texttt{sd2}}_{y}}\)
  • sd_y_est1: The standard deviation for the trait inferred from the reported sample size, median standard errors for the SNP-trait assocations and SNP variances.
    • \(\widehat{\texttt{sd1}}_{y} = \frac{\sqrt{n} \times median({se}_j)}{C}\),
    • \(C = median(\frac{1}{\sqrt{2 \times {MAF}_j \times (1 - {MAF}_j)}})\),
    • and \({se}_j\) is the reported standard error.
  • sd_y_est2: The standard deviation for the trait inferred from the reported sample size, Z statistics for the SNP-trait effects (beta/se) and allele frequency.
    • \(\widehat{\texttt{sd2}}_{y} = median(\widehat{sd_j})\),
    • \(\widehat{sd_j} = \frac{\beta_j}{\widehat{\beta_j^{std}}}\),

r2 metrics

Sum of variance explained, calculated from the clumped top hits sample.

  • r2_sum<*>: r2 statistics under various assumptions
    • 1: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var1}}}\), \(\texttt{var1} = 1\).
    • 2: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var2}}}\), \(\texttt{var2} = {\widehat{\texttt{sd1}}_{y}}^2\),
    • 3: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var3}}}\), \(\texttt{var3} = {\widehat{\texttt{sd2}}_{y}}^2\),
    • 4: \(r^2 = \sum_j{\frac{F_j}{F_j + n - 2}}\), \(F = \frac{\beta_j^2}{{se}_j^2}\).

LDSC metrics

Metrics from LD regression

  • ldsc_nsnp_merge_refpanel_ld: Number of remaining SNPs after merging with reference panel LD.
  • ldsc_nsnp_merge_regression_ld: Number of remaining SNPs after merging with regression SNP LD.
  • ldsc_observed_scale_h2_{beta,se} Coefficient value and SE for total observed scale h2.
  • ldsc_intercept_{beta,se}: Coefficient value and SE for intercept. Intercept is expected to be 1.
  • ldsc_lambda_gc: Lambda GC statistics.
  • ldsc_mean_chisq: Mean \(\chi^2\) statistics.
  • ldsc_ratio: \(\frac{\texttt{ldsc_intercept_beta} - 1}{\texttt{ldsc_mean_chisq} - 1}\), the proportion of the inflation in the mean \(\chi^2\) that the LD Score regression intercepts ascribes to causes other than polygenic heritability. The value of ratio should be close to zero, though in practice values of 0.1-0.2 are not uncommon, probably due to sample/reference LD Score mismatch or model misspecification (e.g., low LD variants have slightly higher \(h^2\) per SNP).

Flags

When a metric needs attention, the flag should return TRUE.

  • af_correlation: abs(af_correlation) < 0.7.
  • inflation_factor: inflation_factor > 1.2.
  • n: n (max reported sample size) < 10000.
  • is_snpid_non_unique: NOT is_snpid_unique.
  • mean_EFFECT_nonfinite: mean(EFFECT) is NA, NaN, or Inf.
  • mean_EFFECT_05: abs(mean(EFFECT)) > 0.5.
  • mean_EFFECT_01: abs(mean(EFFECT)) > 0.1.
  • mean_chisq: ldsc_mean_chisq > 1.3 or ldsc_mean_chisq < 0.7.
  • n_p_sig: n_p_sig > 1000.
  • miss_<*>: n_miss_<*> / n_snps > 0.01.
  • ldsc_ratio: ldsc_ratio > 0.5
  • ldsc_intercept_beta: ldsc_intercept_beta > 1.5
  • n_clumped_hits: n_clumped_hits > 1000
  • r2_sum<*>: r2_sum<*> > 0.5

Plots

  • Manhattan plot
    • Red line: \(-log_{10}^{5 \times 10^{-8}}\)
    • Blue line: \(-log_{10}^{5 \times 10^{-5}}\)
  • QQ plot
  • AF plot
  • P-Z plot
  • beta_std plot: Scatter plot between \(\widehat{\beta_j^{std}}\) and \(\beta_j\)

Diagnostics

Details

Summary stats

skim_type skim_variable n_missing complete_rate character.min character.max character.empty character.n_unique character.whitespace logical.mean logical.count numeric.mean numeric.sd numeric.p0 numeric.p25 numeric.p50 numeric.p75 numeric.p100 numeric.hist
character ID 568685 0.9579547 3 12 0 12944390 0 NA NA NA NA NA NA NA NA NA NA
character REF 0 1.0000000 1 101 0 16685 0 NA NA NA NA NA NA NA NA NA NA
character ALT 0 1.0000000 1 342 0 73633 0 NA NA NA NA NA NA NA NA NA NA
logical N 13525533 0.0000000 NA NA NA NA NA NaN : NA NA NA NA NA NA NA NA
numeric CHROM 0 1.0000000 NA NA NA NA NA NA NA 8.751170e+00 5.959679e+00 1.0000e+00 4.000000e+00 8.000000e+00 1.300000e+01 23 ▇▅▅▂▂
numeric POS 0 1.0000000 NA NA NA NA NA NA NA 7.981845e+07 5.497535e+07 3.0200e+02 3.498962e+07 7.150886e+07 1.144903e+08 249220724 ▇▇▅▂▁
numeric EFFECT 0 1.0000000 NA NA NA NA NA NA NA NaN NaN -Inf -1.040540e-02 5.530000e-05 1.063960e-02 Inf ▁▁▁▇▁
numeric SE 0 1.0000000 NA NA NA NA NA NA NA Inf NaN 3.4984e-03 6.130400e-03 1.746360e-02 5.988120e-02 Inf ▇▁▁▁▁
numeric PVAL 0 1.0000000 NA NA NA NA NA NA NA 4.942361e-01 2.922202e-01 0.0000e+00 2.399999e-01 4.899999e-01 7.499995e-01 1 ▇▇▇▇▇
numeric PVAL_ztest 14331 0.9989404 NA NA NA NA NA NA NA 4.936993e-01 2.918833e-01 0.0000e+00 2.389015e-01 4.912973e-01 7.465426e-01 1 ▇▇▇▇▇
numeric AF 0 1.0000000 NA NA NA NA NA NA NA 2.033787e-01 2.966140e-01 0.0000e+00 2.064000e-03 3.008700e-02 3.154760e-01 1 ▇▁▁▁▁
numeric AF_reference 2715836 0.7992067 NA NA NA NA NA NA NA 1.839050e-01 2.407114e-01 0.0000e+00 9.984000e-04 6.948880e-02 2.945290e-01 1 ▇▂▁▁▁

Head and tail

CHROM POS ID REF ALT EFFECT SE PVAL PVAL_ztest AF AF_reference N
1 751343 rs28544273 T A -0.0039229 0.0069701 0.5700002 0.5735576 0.147575 0.242612 NA
1 751756 rs143225517 T C -0.0038510 0.0069538 0.5800000 0.5797196 0.147109 0.242212 NA
1 752566 rs3094315 G A 0.0041934 0.0064371 0.5099998 0.5147576 0.842815 0.718251 NA
1 752894 rs3131971 T C 0.0041260 0.0067790 0.5400003 0.5427653 0.849755 0.753195 NA
1 753405 rs3115860 C A 0.0038270 0.0069041 0.5800000 0.5793690 0.851609 0.751797 NA
1 753425 rs3131970 T C 0.0038549 0.0068751 0.5700002 0.5749975 0.850948 0.749002 NA
1 756285 rs1557551112 A ATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGG 0.0058722 0.0073375 0.4199997 0.4235369 0.859010 NA NA
1 759293 rs10157329 T A -0.0006318 0.0081929 0.9400001 0.9385334 0.122653 0.154153 NA
1 759700 rs989694037 T C 0.0039961 0.0067576 0.5500004 0.5542929 0.845951 NA NA
1 759837 rs114111569 T A 0.0037049 0.0069766 0.5999997 0.5953885 0.850978 0.752596 NA
CHROM POS ID REF ALT EFFECT SE PVAL PVAL_ztest AF AF_reference N
23 154819368 rs782310 T C 0.0046693 0.0047907 0.3300000 0.3297313 0.774235 0.6439740 NA
23 154821956 rs5940536 G A -0.0334376 0.0450422 0.4600002 0.4578683 0.001536 0.0389404 NA
23 154822874 rs1084450 A T 0.0046884 0.0048214 0.3300000 0.3308424 0.774002 0.6439740 NA
23 154825665 rs782308 T A 0.0047232 0.0048550 0.3300000 0.3306174 0.773338 0.6439740 NA
23 154826161 rs782307 G C 0.0051690 0.0048344 0.2800000 0.2849728 0.763587 0.5343050 NA
23 154826774 rs782306 G A 0.0047336 0.0048666 0.3300000 0.3307139 0.772455 0.6384110 NA
23 154827160 rs809138 T C 0.0046911 0.0048738 0.3400001 0.3357914 0.772675 0.6381460 NA
23 154827280 rs5983745 T C 0.0046883 0.0048816 0.3400001 0.3368588 0.773356 0.6442380 NA
23 154830377 rs5983658 C T 0.0047449 0.0049175 0.3300000 0.3345875 0.771466 0.6384110 NA
23 154830744 rs10782079 A G 0.0047483 0.0049302 0.3400001 0.3354927 0.771938 0.6439740 NA

bcf preview

1   751343  rs28544273  T   A   .   PASS    AF=0.147575 ES:SE:LP:AF:SI:ID   -0.00392291:0.0069701:0.244125:0.147575:0.902227:rs28544273
1   751756  rs28527770  T   C   .   PASS    AF=0.147109 ES:SE:LP:AF:SI:ID   -0.00385097:0.00695379:0.236572:0.147109:0.907138:rs28527770
1   752566  rs3094315   G   A   .   PASS    AF=0.842815 ES:SE:LP:AF:SI:ID   0.00419344:0.00643711:0.29243:0.842815:0.99888:rs3094315
1   752894  rs3131971   T   C   .   PASS    AF=0.849755 ES:SE:LP:AF:SI:ID   0.00412596:0.00677902:0.267606:0.849755:0.935874:rs3131971
1   753405  rs3115860   C   A   .   PASS    AF=0.851609 ES:SE:LP:AF:SI:ID   0.003827:0.00690412:0.236572:0.851609:0.913917:rs3115860
1   753425  rs1431026348    T   C   .   PASS    AF=0.850948 ES:SE:LP:AF:SI:ID   0.00385492:0.00687511:0.244125:0.850948:0.91823:rs1431026348
1   756285  rs1557551112    A   ATCCACCCTGTCTACACTACCTGCTTGTCCAGCAGG    .   PASS    AF=0.85901  ES:SE:LP:AF:SI:ID   0.00587217:0.00733746:0.376751:0.85901:0.850959:rs1557551112
1   759293  rs10157329  T   A   .   PASS    AF=0.122653 ES:SE:LP:AF:SI:ID   -0.000631782:0.0081929:0.0268721:0.122653:0.771496:rs10157329
1   759700  rs989694037 T   C   .   PASS    AF=0.845951 ES:SE:LP:AF:SI:ID   0.00399606:0.00675764:0.259637:0.845951:0.928757:rs989694037
1   759837  rs3115851   T   A   .   PASS    AF=0.850978 ES:SE:LP:AF:SI:ID   0.00370489:0.00697662:0.221849:0.850978:0.895896:rs3115851
1   760912  rs1048488   C   T   .   PASS    AF=0.844569 ES:SE:LP:AF:SI:ID   0.00407427:0.00677193:0.259637:0.844569:0.921597:rs1048488
1   761147  rs3115850   T   C   .   PASS    AF=0.844276 ES:SE:LP:AF:SI:ID   0.00407361:0.00677426:0.259637:0.844276:0.9202:rs3115850
1   761752  rs1057213   C   T   .   PASS    AF=0.849395 ES:SE:LP:AF:SI:ID   0.00376007:0.00699787:0.229148:0.849395:0.886882:rs1057213
1   762273  rs3115849   G   A   .   PASS    AF=0.848444 ES:SE:LP:AF:SI:ID   0.00488125:0.00723204:0.30103:0.848444:0.842636:rs3115849
1   762589  rs772021405 G   C   .   PASS    AF=0.855008 ES:SE:LP:AF:SI:ID   0.00481545:0.00731166:0.29243:0.855008:0.846074:rs772021405
1   762592  rs1209077270    C   G   .   PASS    AF=0.855002 ES:SE:LP:AF:SI:ID   0.00483599:0.00731287:0.29243:0.855002:0.84584:rs1209077270
1   762601  rs3131949   T   C   .   PASS    AF=0.855095 ES:SE:LP:AF:SI:ID   0.00482147:0.00731315:0.29243:0.855095:0.846024:rs3131949
1   762632  rs3131948   T   A   .   PASS    AF=0.855311 ES:SE:LP:AF:SI:ID   0.00481596:0.00731345:0.29243:0.855311:0.846597:rs3131948
1   764191  rs7515915   T   G   .   PASS    AF=0.138448 ES:SE:LP:AF:SI:ID   -0.00473686:0.00754902:0.275724:0.138448:0.822746:rs7515915
1   769138  rs1483790918    C   CAT .   PASS    AF=0.857477 ES:SE:LP:AF:SI:ID   0.00383607:0.00769536:0.207608:0.857477:0.787625:rs1483790918
1   769223  rs60320384  C   G   .   PASS    AF=0.133716 ES:SE:LP:AF:SI:ID   -0.00441961:0.00798751:0.236572:0.133716:0.766402:rs60320384
1   771823  rs2977605   T   C   .   PASS    AF=0.859275 ES:SE:LP:AF:SI:ID   0.00424054:0.00775144:0.236572:0.859275:0.787427:rs2977605
1   771967  rs59066358  G   A   .   PASS    AF=0.131035 ES:SE:LP:AF:SI:ID   -0.00396951:0.00814338:0.200659:0.131035:0.756236:rs59066358
1   772755  rs2905039   A   C   .   PASS    AF=0.860455 ES:SE:LP:AF:SI:ID   0.00416402:0.00784035:0.221849:0.860455:0.776877:rs2905039
1   775181  rs61768182  A   G   .   PASS    AF=0.141821 ES:SE:LP:AF:SI:ID   -0.00485695:0.0078043:0.275724:0.141821:0.772064:rs61768182
1   775659  rs2905035   A   G   .   PASS    AF=0.851873 ES:SE:LP:AF:SI:ID   0.00500343:0.00761095:0.29243:0.851873:0.786221:rs2905035
1   777122  rs2980319   A   T   .   PASS    AF=0.852971 ES:SE:LP:AF:SI:ID   0.00514688:0.00769068:0.30103:0.852971:0.77648:rs2980319
1   799276  rs1361372105    G   A   .   PASS    AF=0.012148 ES:SE:LP:AF:SI:ID   0.0494414:0.0252088:1.30103:0.012148:0.729742:rs1361372105
1   842685  rs145037928 T   C   .   PASS    AF=0.018403 ES:SE:LP:AF:SI:ID   -0.0356415:0.0207051:1.07058:0.018403:0.715508:rs145037928
1   843309  rs535993749 C   T   .   PASS    AF=0.006826 ES:SE:LP:AF:SI:ID   -0.00840568:0.0337594:0.09691:0.006826:0.718574:rs535993749
1   845635  rs117086422 C   T   .   PASS    AF=0.141349 ES:SE:LP:AF:SI:ID   0.000746383:0.00713231:0.0362122:0.141349:0.905881:rs117086422
1   846078  rs778265812 C   T   .   PASS    AF=0.141537 ES:SE:LP:AF:SI:ID   0.00106256:0.00707318:0.0555173:0.141537:0.917285:rs778265812
1   846808  rs4475691   C   T   .   PASS    AF=0.140326 ES:SE:LP:AF:SI:ID   0.00103999:0.00674943:0.0555173:0.140326:0.999313:rs4475691
1   846864  rs1269142199    G   C   .   PASS    AF=0.139499 ES:SE:LP:AF:SI:ID   0.00100754:0.0068077:0.0555173:0.139499:0.988228:rs1269142199
1   847228  rs3905286   C   T   .   PASS    AF=0.140786 ES:SE:LP:AF:SI:ID   0.000287255:0.00691916:0.0132283:0.140786:0.955967:rs3905286
1   847491  rs1158719307    G   A   .   PASS    AF=0.141555 ES:SE:LP:AF:SI:ID   0.000164684:0.0069219:0.00877392:0.141555:0.951854:rs1158719307
1   848090  rs4246505   G   A   .   PASS    AF=0.136188 ES:SE:LP:AF:SI:ID   0.000691171:0.00705125:0.0362122:0.136188:0.945283:rs4246505
1   848445  rs1156895099    G   A   .   PASS    AF=0.14215  ES:SE:LP:AF:SI:ID   0.000164832:0.00694359:0.00877392:0.14215:0.944351:rs1156895099
1   848456  rs11507767  A   G   .   PASS    AF=0.142144 ES:SE:LP:AF:SI:ID   3.05206e-05:0.00695163:-0:0.142144:0.942487:rs11507767
1   848654  rs5772026   T   TG  .   PASS    AF=0.86371  ES:SE:LP:AF:SI:ID   -0.000283711:0.00703769:0.0132283:0.86371:0.948043:rs5772026
1   848738  rs3829741   C   T   .   PASS    AF=0.137163 ES:SE:LP:AF:SI:ID   0.000312703:0.00701327:0.0177288:0.137163:0.949883:rs3829741
1   848828  rs3841265   G   GA  .   PASS    AF=0.848303 ES:SE:LP:AF:SI:ID   -0.0024056:0.00759408:0.124939:0.848303:0.784475:rs3841265
1   849440  rs79376265  C   T   .   PASS    AF=0.14608  ES:SE:LP:AF:SI:ID   0.00243943:0.00755245:0.124939:0.14608:0.806107:rs79376265
1   850062  rs28723578  A   T   .   PASS    AF=0.142394 ES:SE:LP:AF:SI:ID   0.000148296:0.00697022:0.00877392:0.142394:0.937013:rs28723578
1   850123  rs28622257  C   T   .   PASS    AF=0.13792  ES:SE:LP:AF:SI:ID   0.000339678:0.00704056:0.0177288:0.13792:0.940581:rs28622257
1   850528  rs114889920 A   G   .   PASS    AF=0.146372 ES:SE:LP:AF:SI:ID   0.00246974:0.00749196:0.130768:0.146372:0.815377:rs114889920
1   851190  rs28609852  G   A   .   PASS    AF=0.141766 ES:SE:LP:AF:SI:ID   7.47504e-05:0.00700639:0.00436481:0.141766:0.931849:rs28609852
1   851198  rs146517096 G   A   .   PASS    AF=0.007081 ES:SE:LP:AF:SI:ID   -0.0112913:0.0331928:0.136677:0.007081:0.717129:rs146517096
1   851204  rs28552953  G   C   .   PASS    AF=0.145063 ES:SE:LP:AF:SI:ID   -0.000146106:0.00702486:0.00877392:0.145063:0.912927:rs28552953
1   852664  rs28605311  C   T   .   PASS    AF=0.139083 ES:SE:LP:AF:SI:ID   0.000181338:0.0070661:0.00877392:0.139083:0.930206:rs28605311