manhattan_plot
qq_plot
af_plot
pz_plot
beta_std_plot
{
"fileformat": "VCFv4.2",
"FILTER": "<ID=PASS,Description=\"All filters passed\">",
"INFO": "<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency\">",
"FORMAT": "<ID=ES,Number=A,Type=Float,Description=\"Effect size estimate relative to the alternative allele\">",
"FORMAT.1": "<ID=SE,Number=A,Type=Float,Description=\"Standard error of effect size estimate\">",
"FORMAT.2": "<ID=LP,Number=A,Type=Float,Description=\"-log10 p-value for effect estimate\">",
"FORMAT.3": "<ID=AF,Number=A,Type=Float,Description=\"Alternate allele frequency in the association study\">",
"FORMAT.4": "<ID=SS,Number=A,Type=Float,Description=\"Sample size used to estimate genetic effect\">",
"FORMAT.5": "<ID=EZ,Number=A,Type=Float,Description=\"Z-score provided if it was used to derive the EFFECT and SE fields\">",
"FORMAT.6": "<ID=SI,Number=A,Type=Float,Description=\"Accuracy score of summary data imputation\">",
"FORMAT.7": "<ID=NC,Number=A,Type=Float,Description=\"Number of cases used to estimate genetic effect\">",
"FORMAT.8": "<ID=ID,Number=1,Type=String,Description=\"Study variant identifier\">",
"META": "<ID=TotalVariants,Number=1,Type=Integer,Description=\"Total number of variants in input\">",
"META.1": "<ID=VariantsNotRead,Number=1,Type=Integer,Description=\"Number of variants that could not be read\">",
"META.2": "<ID=HarmonisedVariants,Number=1,Type=Integer,Description=\"Total number of harmonised variants\">",
"META.3": "<ID=VariantsNotHarmonised,Number=1,Type=Integer,Description=\"Total number of variants that could not be harmonised\">",
"META.4": "<ID=SwitchedAlleles,Number=1,Type=Integer,Description=\"Total number of variants strand switched\">",
"META.5": "<ID=TotalControls,Number=1,Type=Integer,Description=\"Total number of controls in the association study\">",
"META.6": "<ID=TotalCases,Number=1,Type=Integer,Description=\"Total number of cases in the association study\">",
"META.7": "<ID=StudyType,Number=1,Type=String,Description=\"Type of GWAS study [Continuous or CaseControl]\">",
"SAMPLE": "<ID=ieu-a-1229,TotalVariants=15240547,VariantsNotRead=474,HarmonisedVariants=15240073,VariantsNotHarmonised=0,SwitchedAlleles=0,StudyType=Continuous>",
"contig": "<ID=1,length=249250621,assembly=HG19/GRCh37>",
"contig.1": "<ID=2,length=243199373,assembly=HG19/GRCh37>",
"contig.2": "<ID=3,length=198022430,assembly=HG19/GRCh37>",
"contig.3": "<ID=4,length=191154276,assembly=HG19/GRCh37>",
"contig.4": "<ID=5,length=180915260,assembly=HG19/GRCh37>",
"contig.5": "<ID=6,length=171115067,assembly=HG19/GRCh37>",
"contig.6": "<ID=7,length=159138663,assembly=HG19/GRCh37>",
"contig.7": "<ID=8,length=146364022,assembly=HG19/GRCh37>",
"contig.8": "<ID=9,length=141213431,assembly=HG19/GRCh37>",
"contig.9": "<ID=10,length=135534747,assembly=HG19/GRCh37>",
"contig.10": "<ID=11,length=135006516,assembly=HG19/GRCh37>",
"contig.11": "<ID=12,length=133851895,assembly=HG19/GRCh37>",
"contig.12": "<ID=13,length=115169878,assembly=HG19/GRCh37>",
"contig.13": "<ID=14,length=107349540,assembly=HG19/GRCh37>",
"contig.14": "<ID=15,length=102531392,assembly=HG19/GRCh37>",
"contig.15": "<ID=16,length=90354753,assembly=HG19/GRCh37>",
"contig.16": "<ID=17,length=81195210,assembly=HG19/GRCh37>",
"contig.17": "<ID=18,length=78077248,assembly=HG19/GRCh37>",
"contig.18": "<ID=19,length=59128983,assembly=HG19/GRCh37>",
"contig.19": "<ID=20,length=63025520,assembly=HG19/GRCh37>",
"contig.20": "<ID=21,length=48129895,assembly=HG19/GRCh37>",
"contig.21": "<ID=22,length=51304566,assembly=HG19/GRCh37>",
"contig.22": "<ID=X,length=155270560,assembly=HG19/GRCh37>",
"contig.23": "<ID=Y,length=59373566,assembly=HG19/GRCh37>",
"contig.24": "<ID=MT,length=16569,assembly=HG19/GRCh37>",
"contig.25": "<ID=GL000207.1,length=4262,assembly=HG19/GRCh37>",
"contig.26": "<ID=GL000226.1,length=15008,assembly=HG19/GRCh37>",
"contig.27": "<ID=GL000229.1,length=19913,assembly=HG19/GRCh37>",
"contig.28": "<ID=GL000231.1,length=27386,assembly=HG19/GRCh37>",
"contig.29": "<ID=GL000210.1,length=27682,assembly=HG19/GRCh37>",
"contig.30": "<ID=GL000239.1,length=33824,assembly=HG19/GRCh37>",
"contig.31": "<ID=GL000235.1,length=34474,assembly=HG19/GRCh37>",
"contig.32": "<ID=GL000201.1,length=36148,assembly=HG19/GRCh37>",
"contig.33": "<ID=GL000247.1,length=36422,assembly=HG19/GRCh37>",
"contig.34": "<ID=GL000245.1,length=36651,assembly=HG19/GRCh37>",
"contig.35": "<ID=GL000197.1,length=37175,assembly=HG19/GRCh37>",
"contig.36": "<ID=GL000203.1,length=37498,assembly=HG19/GRCh37>",
"contig.37": "<ID=GL000246.1,length=38154,assembly=HG19/GRCh37>",
"contig.38": "<ID=GL000249.1,length=38502,assembly=HG19/GRCh37>",
"contig.39": "<ID=GL000196.1,length=38914,assembly=HG19/GRCh37>",
"contig.40": "<ID=GL000248.1,length=39786,assembly=HG19/GRCh37>",
"contig.41": "<ID=GL000244.1,length=39929,assembly=HG19/GRCh37>",
"contig.42": "<ID=GL000238.1,length=39939,assembly=HG19/GRCh37>",
"contig.43": "<ID=GL000202.1,length=40103,assembly=HG19/GRCh37>",
"contig.44": "<ID=GL000234.1,length=40531,assembly=HG19/GRCh37>",
"contig.45": "<ID=GL000232.1,length=40652,assembly=HG19/GRCh37>",
"contig.46": "<ID=GL000206.1,length=41001,assembly=HG19/GRCh37>",
"contig.47": "<ID=GL000240.1,length=41933,assembly=HG19/GRCh37>",
"contig.48": "<ID=GL000236.1,length=41934,assembly=HG19/GRCh37>",
"contig.49": "<ID=GL000241.1,length=42152,assembly=HG19/GRCh37>",
"contig.50": "<ID=GL000243.1,length=43341,assembly=HG19/GRCh37>",
"contig.51": "<ID=GL000242.1,length=43523,assembly=HG19/GRCh37>",
"contig.52": "<ID=GL000230.1,length=43691,assembly=HG19/GRCh37>",
"contig.53": "<ID=GL000237.1,length=45867,assembly=HG19/GRCh37>",
"contig.54": "<ID=GL000233.1,length=45941,assembly=HG19/GRCh37>",
"contig.55": "<ID=GL000204.1,length=81310,assembly=HG19/GRCh37>",
"contig.56": "<ID=GL000198.1,length=90085,assembly=HG19/GRCh37>",
"contig.57": "<ID=GL000208.1,length=92689,assembly=HG19/GRCh37>",
"contig.58": "<ID=GL000191.1,length=106433,assembly=HG19/GRCh37>",
"contig.59": "<ID=GL000227.1,length=128374,assembly=HG19/GRCh37>",
"contig.60": "<ID=GL000228.1,length=129120,assembly=HG19/GRCh37>",
"contig.61": "<ID=GL000214.1,length=137718,assembly=HG19/GRCh37>",
"contig.62": "<ID=GL000221.1,length=155397,assembly=HG19/GRCh37>",
"contig.63": "<ID=GL000209.1,length=159169,assembly=HG19/GRCh37>",
"contig.64": "<ID=GL000218.1,length=161147,assembly=HG19/GRCh37>",
"contig.65": "<ID=GL000220.1,length=161802,assembly=HG19/GRCh37>",
"contig.66": "<ID=GL000213.1,length=164239,assembly=HG19/GRCh37>",
"contig.67": "<ID=GL000211.1,length=166566,assembly=HG19/GRCh37>",
"contig.68": "<ID=GL000199.1,length=169874,assembly=HG19/GRCh37>",
"contig.69": "<ID=GL000217.1,length=172149,assembly=HG19/GRCh37>",
"contig.70": "<ID=GL000216.1,length=172294,assembly=HG19/GRCh37>",
"contig.71": "<ID=GL000215.1,length=172545,assembly=HG19/GRCh37>",
"contig.72": "<ID=GL000205.1,length=174588,assembly=HG19/GRCh37>",
"contig.73": "<ID=GL000219.1,length=179198,assembly=HG19/GRCh37>",
"contig.74": "<ID=GL000224.1,length=179693,assembly=HG19/GRCh37>",
"contig.75": "<ID=GL000223.1,length=180455,assembly=HG19/GRCh37>",
"contig.76": "<ID=GL000195.1,length=182896,assembly=HG19/GRCh37>",
"contig.77": "<ID=GL000212.1,length=186858,assembly=HG19/GRCh37>",
"contig.78": "<ID=GL000222.1,length=186861,assembly=HG19/GRCh37>",
"contig.79": "<ID=GL000200.1,length=187035,assembly=HG19/GRCh37>",
"contig.80": "<ID=GL000193.1,length=189789,assembly=HG19/GRCh37>",
"contig.81": "<ID=GL000194.1,length=191469,assembly=HG19/GRCh37>",
"contig.82": "<ID=GL000225.1,length=211173,assembly=HG19/GRCh37>",
"contig.83": "<ID=GL000192.1,length=547496,assembly=HG19/GRCh37>",
"gwas_harmonisation_command": "--json /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ieu-a-1229_data.json --ref /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/QC/genomes/b37/human_g1k_v37.fasta; 1.1.1",
"file_date": "2020-02-04T12:03:51.621433",
"bcftools_annotateVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
"bcftools_annotateCommand": "annotate -a /mnt/storage/home/gh13047/mr-eve/vcf-reference-datasets/dbsnp/dbsnp.v153.b37.vcf.gz -c ID -o /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ieu-a-1229.vcf.gz -O z /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ieu-a-1229_data.vcf.gz; Date=Tue Feb 4 12:30:26 2020",
"bcftools_viewVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
"bcftools_viewCommand": "view -h /mnt/storage/private/mrcieu/research/scratch/IGD/data/public/ieu-a-1229/ieu-a-1229.vcf.gz; Date=Sun May 10 14:13:14 2020"
}
*********************************************************************
* LD Score Regression (LDSC)
* Version 1.0.1
* (C) 2014-2019 Brendan Bulik-Sullivan and Hilary Finucane
* Broad Institute of MIT and Harvard / MIT Department of Mathematics
* GNU General Public License v3
*********************************************************************
Call:
./ldsc.py \
--h2 /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ieu-a-1229.vcf.gz \
--ref-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/ \
--out /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ldsc.txt \
--w-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/
Beginning analysis at Tue Feb 4 12:56:15 2020
Reading summary statistics from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1229/ieu-a-1229.vcf.gz ...
Read summary statistics for 15240073 SNPs.
Reading reference panel LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read reference panel LD Scores for 1290028 SNPs.
Removing partitioned LD Scores with zero variance.
Reading regression weight LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read regression weight LD Scores for 1290028 SNPs.
After merging with reference panel LD, 1218950 SNPs remain.
After merging with regression SNP LD, 1218950 SNPs remain.
Using two-step estimator with cutoff at 30.
Total Observed scale h2: 0.0157 (0.0126)
Lambda GC: 1.0272
Mean Chi^2: 1.0335
Intercept: 1.02 (0.0064)
Ratio: 0.5967 (0.1915)
Analysis finished at Tue Feb 4 12:58:46 2020
Total time elapsed: 2.0m:31.78s
{
"af_correlation": 0.9601,
"inflation_factor": 1.0513,
"mean_EFFECT": -0.5157,
"n": 43907,
"n_snps": 15240073,
"n_clumped_hits": 8,
"n_p_sig": 186,
"n_mono": 0,
"n_ns": 775455,
"n_mac": 255269,
"is_snpid_unique": false,
"n_miss_EFFECT": 0,
"n_miss_SE": 0,
"n_miss_PVAL": 0,
"n_miss_AF": 1334,
"n_miss_AF_reference": 159611,
"n_est": 42340.1555,
"ratio_se_n": 0.982,
"mean_diff": 0.5126,
"ratio_diff": 4.7016,
"sd_y_est1": 4.6724,
"sd_y_est2": 4.5883,
"r2_sum1": 0.1555,
"r2_sum2": 0.0071,
"r2_sum3": 0.0074,
"r2_sum4": 0.0076,
"ldsc_nsnp_merge_refpanel_ld": 1218950,
"ldsc_nsnp_merge_regression_ld": 1218950,
"ldsc_observed_scale_h2_beta": 0.0157,
"ldsc_observed_scale_h2_se": 0.0126,
"ldsc_intercept_beta": 1.02,
"ldsc_intercept_se": 0.0064,
"ldsc_lambda_gc": 1.0272,
"ldsc_mean_chisq": 1.0335,
"ldsc_ratio": 0.597
}
name | value |
---|---|
af_correlation | FALSE |
inflation_factor | FALSE |
n | FALSE |
is_snpid_non_unique | TRUE |
mean_EFFECT_nonfinite | FALSE |
mean_EFFECT_05 | TRUE |
mean_EFFECT_01 | TRUE |
mean_chisq | FALSE |
n_p_sig | FALSE |
miss_EFFECT | FALSE |
miss_SE | FALSE |
miss_PVAL | FALSE |
ldsc_ratio | TRUE |
ldsc_intercept_beta | FALSE |
n_clumped_hits | FALSE |
r2_sum1 | FALSE |
r2_sum2 | FALSE |
r2_sum3 | FALSE |
r2_sum4 | FALSE |
General metrics
af_correlation
: Correlation coefficient between AF
and AF_reference
.inflation_factor
(lambda
): Genomic inflation factor.mean_EFFECT
: Mean of EFFECT
size.n
: Maximum value of reported sample size across all SNPs, \(n\).n_clumped_hits
: Number of clumped hits.n_snps
: Number of SNPsn_p_sig
: Number of SNPs with pvalue below 5e-8
.n_mono
: Number of monomorphic (MAF == 1
or MAF == 0
) SNPs.n_ns
: Number of SNPs with nonsense values:
A, C, G or T
.< 0
or > 1
.<= 0
or = Infinity
).< 0
or > 1
.n_mac
: Number of cases where MAC
(\(2 \times N \times MAF\)) is less than 6
.is_snpid_unique
: true
if the combination of ID
REF
ALT
is unique and therefore no duplication in snpid.n_miss_<*>
: Number of NA
observations for <*>
column.se_n metrics
n_est
: Estimated sample size value, \(\widehat{n}\).ratio_se_n
: \(\texttt{ratio_se_n} = \frac{\sqrt{\widehat{n}}}{\sqrt{n}}\). We expect ratio_se_n
to be 1. When it is not 1, it implies that the trait did not have a variance of 1, the reported sample size is wrong, or that the SNP-level effective sample sizes differ markedly from the reported sample size.mean_diff
: \(\texttt{mean_diff} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta_j}{\texttt{n_snps}}\), mean difference between the standardised beta, predicted from P-values, and the observed beta. The difference should be very close to zero if trait has a variance of 1.
ratio_diff
: \(\texttt{ratio_diff} = |\frac{\texttt{mean_diff}}{\texttt{mean_diff2}}|\), absolute ratio between the mean of diff
and the mean of diff2
(expected difference between the standardised beta predicted from P-values, and the standardised beta derived from the observed beta divided by the predicted SD; NOT reported). The ratio should be close to 1. If different from 1, then implies that the betas are not in a standard deviation scale.
sd_y_est1
: The standard deviation for the trait inferred from the reported sample size, median standard errors for the SNP-trait assocations and SNP variances.
sd_y_est2
: The standard deviation for the trait inferred from the reported sample size, Z statistics for the SNP-trait effects (beta/se) and allele frequency.
r2 metrics
Sum of variance explained, calculated from the clumped top hits sample.
r2_sum<*>
: r2
statistics under various assumptions
1
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var1}}}\), \(\texttt{var1} = 1\).2
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var2}}}\), \(\texttt{var2} = {\widehat{\texttt{sd1}}_{y}}^2\),3
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var3}}}\), \(\texttt{var3} = {\widehat{\texttt{sd2}}_{y}}^2\),4
: \(r^2 = \sum_j{\frac{F_j}{F_j + n - 2}}\), \(F = \frac{\beta_j^2}{{se}_j^2}\).LDSC metrics
Metrics from LD regression
ldsc_nsnp_merge_refpanel_ld
: Number of remaining SNPs after merging with reference panel LD.ldsc_nsnp_merge_regression_ld
: Number of remaining SNPs after merging with regression SNP LD.ldsc_observed_scale_h2_{beta,se}
Coefficient value and SE for total observed scale h2.ldsc_intercept_{beta,se}
: Coefficient value and SE for intercept. Intercept is expected to be 1.ldsc_lambda_gc
: Lambda GC statistics.ldsc_mean_chisq
: Mean \(\chi^2\) statistics.ldsc_ratio
: \(\frac{\texttt{ldsc_intercept_beta} - 1}{\texttt{ldsc_mean_chisq} - 1}\), the proportion of the inflation in the mean \(\chi^2\) that the LD Score regression intercepts ascribes to causes other than polygenic heritability. The value of ratio should be close to zero, though in practice values of 0.1-0.2 are not uncommon, probably due to sample/reference LD Score mismatch or model misspecification (e.g., low LD variants have slightly higher \(h^2\) per SNP).Flags
When a metric needs attention, the flag should return TRUE.
af_correlation
: abs(af_correlation)
< 0.7.inflation_factor
: inflation_factor
> 1.2.n
: n
(max reported sample size) < 10000.is_snpid_non_unique
: NOT is_snpid_unique
.mean_EFFECT_nonfinite
: mean(EFFECT)
is NA
, NaN
, or Inf
.mean_EFFECT_05
: abs(mean(EFFECT))
> 0.5.mean_EFFECT_01
: abs(mean(EFFECT))
> 0.1.mean_chisq
: ldsc_mean_chisq
> 1.3 or ldsc_mean_chisq
< 0.7.n_p_sig
: n_p_sig
> 1000.miss_<*>
: n_miss_<*>
/ n_snps
> 0.01.ldsc_ratio
: ldsc_ratio
> 0.5ldsc_intercept_beta
: ldsc_intercept_beta
> 1.5n_clumped_hits
: n_clumped_hits
> 1000r2_sum<*>
: r2_sum<*>
> 0.5Plots
skim_type | skim_variable | n_missing | complete_rate | character.min | character.max | character.empty | character.n_unique | character.whitespace | numeric.mean | numeric.sd | numeric.p0 | numeric.p25 | numeric.p50 | numeric.p75 | numeric.p100 | numeric.hist |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
character | ID | 0 | 1.0000000 | 3 | 47 | 0 | 15240071 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
character | REF | 0 | 1.0000000 | 1 | 101 | 0 | 37391 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
character | ALT | 0 | 1.0000000 | 1 | 105 | 0 | 18040 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
numeric | CHROM | 0 | 1.0000000 | NA | NA | NA | NA | NA | 8.898959e+00 | 6.257405e+00 | 1.0000e+00 | 4.000000e+00 | 7.000000e+00 | 1.400000e+01 | 2.400000e+01 | ▇▆▂▃▂ |
numeric | POS | 0 | 1.0000000 | NA | NA | NA | NA | NA | 7.931397e+07 | 5.683333e+07 | 8.2800e+02 | 3.250930e+07 | 6.965052e+07 | 1.158400e+08 | 2.492402e+08 | ▇▆▅▂▁ |
numeric | EFFECT | 0 | 1.0000000 | NA | NA | NA | NA | NA | -5.157247e-01 | 3.066232e+00 | -2.0420e+01 | -7.542000e-02 | -1.696000e-03 | 6.288000e-02 | 2.042000e+01 | ▁▁▇▁▁ |
numeric | SE | 0 | 1.0000000 | NA | NA | NA | NA | NA | 1.097431e+00 | 7.166866e+00 | 9.7100e-05 | 3.975000e-02 | 1.109000e-01 | 4.224000e-01 | 1.000000e+03 | ▇▁▁▁▁ |
numeric | PVAL | 0 | 1.0000000 | NA | NA | NA | NA | NA | 4.927599e-01 | 2.886971e-01 | 0.0000e+00 | 2.419998e-01 | 4.891995e-01 | 7.418003e-01 | 1.000000e+00 | ▇▇▇▇▇ |
numeric | PVAL_ztest | 0 | 1.0000000 | NA | NA | NA | NA | NA | 4.928251e-01 | 2.886675e-01 | 0.0000e+00 | 2.421394e-01 | 4.892363e-01 | 7.418078e-01 | 9.999999e-01 | ▇▇▇▇▇ |
numeric | AF | 1334 | 0.9999125 | NA | NA | NA | NA | NA | 1.571079e-01 | 2.465365e-01 | 0.0000e+00 | 2.364000e-03 | 2.240000e-02 | 2.150000e-01 | 9.999840e-01 | ▇▁▁▁▁ |
numeric | AF_reference | 159611 | 0.9895269 | NA | NA | NA | NA | NA | 1.568614e-01 | 2.338980e-01 | 0.0000e+00 | 2.995200e-03 | 3.434500e-02 | 2.204470e-01 | 1.000000e+00 | ▇▁▁▁▁ |
numeric | N | 0 | 1.0000000 | NA | NA | NA | NA | NA | 4.390700e+04 | 0.000000e+00 | 4.3907e+04 | 4.390700e+04 | 4.390700e+04 | 4.390700e+04 | 4.390700e+04 | ▁▁▇▁▁ |
CHROM | POS | ID | REF | ALT | EFFECT | SE | PVAL | PVAL_ztest | AF | AF_reference | N |
---|---|---|---|---|---|---|---|---|---|---|---|
1 | 10616 | rs376342519 | CCGCCGTTGCAAAGGCGCGCCG | C | -0.04973 | 0.20220 | 0.8057001 | 0.8057251 | 0.991000 | 0.9930110 | 43907 |
1 | 14933 | rs199856693 | G | A | -0.09456 | 0.13610 | 0.4870999 | 0.4871911 | 0.047970 | 0.0283546 | 43907 |
1 | 15774 | rs374029747 | G | A | 0.47860 | 0.29650 | 0.1065001 | 0.1064916 | 0.006579 | 0.0119808 | 43907 |
1 | 16949 | rs199745162 | A | C | -0.42380 | 0.18530 | 0.0221901 | 0.0221899 | 0.016750 | 0.0139776 | 43907 |
1 | 51479 | rs116400033 | T | A | -0.05150 | 0.05733 | 0.3689997 | 0.3690213 | 0.232100 | 0.1281950 | 43907 |
1 | 52185 | rs201374420 | TTAA | T | 0.49710 | 0.74780 | 0.5061998 | 0.5062105 | 0.005882 | 0.0053914 | 43907 |
1 | 54353 | rs140052487 | C | A | -0.30050 | 0.78270 | 0.7011001 | 0.7010322 | 0.001339 | 0.0089856 | 43907 |
1 | 54490 | rs141149254 | G | A | -0.08068 | 0.06437 | 0.2099999 | 0.2100678 | 0.166100 | 0.0960463 | 43907 |
1 | 55164 | rs3091274 | C | A | -0.14370 | 0.18350 | 0.4335997 | 0.4335647 | 0.980700 | 0.9233230 | 43907 |
1 | 55326 | rs3107975 | T | C | -0.16110 | 0.40190 | 0.6884002 | 0.6885335 | 0.028260 | 0.0459265 | 43907 |
CHROM | POS | ID | REF | ALT | EFFECT | SE | PVAL | PVAL_ztest | AF | AF_reference | N |
---|---|---|---|---|---|---|---|---|---|---|---|
23 | 154925045 | rs509981 | C | T | -0.018720 | 0.03688 | 0.6116993 | 0.6117394 | 0.250000 | 0.3634440 | 43907 |
23 | 154925895 | rs538470 | C | T | -0.009090 | 0.03809 | 0.8114000 | 0.8113806 | 0.252700 | 0.3634440 | 43907 |
23 | 154926376 | rs116490668 | C | T | -0.165500 | 0.61920 | 0.7891999 | 0.7892533 | 0.001859 | 0.0349669 | 43907 |
23 | 154927185 | rs185685661 | T | C | -0.032500 | 0.06419 | 0.6126000 | 0.6126395 | 0.139300 | 0.1796030 | 43907 |
23 | 154927199 | rs645904 | C | T | -0.017960 | 0.03691 | 0.6264999 | 0.6265496 | 0.248000 | 0.3674170 | 43907 |
23 | 154927581 | rs644138 | G | A | -0.004021 | 0.03599 | 0.9110000 | 0.9110411 | 0.299900 | 0.4635760 | 43907 |
23 | 154929412 | rs557132 | C | T | -0.015760 | 0.03695 | 0.6695993 | 0.6697273 | 0.250400 | 0.3568210 | 43907 |
23 | 154929952 | rs4012982 | CAA | C | -0.016310 | 0.03698 | 0.6592999 | 0.6591774 | 0.250900 | 0.3165560 | 43907 |
23 | 154930230 | rs781880 | A | G | -0.018080 | 0.03717 | 0.6267004 | 0.6266738 | 0.249000 | 0.3618540 | 43907 |
24 | 13537468 | rs7203107 | A | G | 0.149600 | 0.20160 | 0.4578002 | 0.4580489 | 0.985590 | NA | 43907 |
1 10616 rs376342519 CCGCCGTTGCAAAGGCGCGCCG C . PASS AF=0.991 ES:SE:LP:AF:SS:ID -0.04973:0.2022:0.0938266:0.991:43907:rs376342519
1 14933 rs199856693 G A . PASS AF=0.04797 ES:SE:LP:AF:SS:ID -0.09456:0.1361:0.312382:0.04797:43907:rs199856693
1 15774 rs374029747 G A . PASS AF=0.006579 ES:SE:LP:AF:SS:ID 0.4786:0.2965:0.97265:0.006579:43907:rs374029747
1 16949 rs199745162 A C . PASS AF=0.01675 ES:SE:LP:AF:SS:ID -0.4238:0.1853:1.65384:0.01675:43907:rs199745162
1 51479 rs116400033 T A . PASS AF=0.2321 ES:SE:LP:AF:SS:ID -0.0515:0.05733:0.432974:0.2321:43907:rs116400033
1 52185 rs201374420 TTAA T . PASS AF=0.005882 ES:SE:LP:AF:SS:ID 0.4971:0.7478:0.295678:0.005882:43907:rs201374420
1 54353 rs140052487 C A . PASS AF=0.001339 ES:SE:LP:AF:SS:ID -0.3005:0.7827:0.15422:0.001339:43907:rs140052487
1 54490 rs141149254 G A . PASS AF=0.1661 ES:SE:LP:AF:SS:ID -0.08068:0.06437:0.677781:0.1661:43907:rs141149254
1 55164 rs3091274 C A . PASS AF=0.9807 ES:SE:LP:AF:SS:ID -0.1437:0.1835:0.362911:0.9807:43907:rs3091274
1 55326 rs3107975 T C . PASS AF=0.02826 ES:SE:LP:AF:SS:ID -0.1611:0.4019:0.162159:0.02826:43907:rs3107975
1 55545 rs28396308 C T . PASS AF=0.2248 ES:SE:LP:AF:SS:ID 0.06142:0.06178:0.494714:0.2248:43907:rs28396308
1 57183 rs368339209 A G . PASS AF=0.0007041 ES:SE:LP:AF:SS:ID -0.8129:1.203:0.301551:0.0007041:43907:rs368339209
1 57292 rs201418760 C T . PASS AF=0.02393 ES:SE:LP:AF:SS:ID 0.1674:0.1734:0.475734:0.02393:43907:rs201418760
1 58814 rs114420996 G A . PASS AF=0.1003 ES:SE:LP:AF:SS:ID 0.1483:0.0867:1.05958:0.1003:43907:rs114420996
1 61543 rs201849102 T C . PASS AF=0.0003079 ES:SE:LP:AF:SS:ID -12.83:9.933:0.706416:0.0003079:43907:rs201849102
1 61743 rs184286948 G C . PASS AF=0.009155 ES:SE:LP:AF:SS:ID 0.2652:0.2518:0.53432:0.009155:43907:rs184286948
1 61920 rs62637820 G A . PASS AF=0.02945 ES:SE:LP:AF:SS:ID 0.01224:0.1527:0.0286778:0.02945:43907:rs62637820
1 63093 rs200092917 G A . PASS AF=0.0207 ES:SE:LP:AF:SS:ID 0.2207:0.1854:0.630784:0.0207:43907:rs200092917
1 64649 rs181431124 A C . PASS AF=0.02715 ES:SE:LP:AF:SS:ID 0.07804:0.1653:0.195997:0.02715:43907:rs181431124
1 66219 rs181028663 A T . PASS AF=0.01624 ES:SE:LP:AF:SS:ID 0.05858:0.2003:0.113566:0.01624:43907:rs181028663
1 68082 rs367789441 T C . PASS AF=0.06526 ES:SE:LP:AF:SS:ID 0.06696:0.09715:0.309184:0.06526:43907:rs367789441
1 68596 rs372212855 T G . PASS AF=0.003797 ES:SE:LP:AF:SS:ID -0.3655:0.3828:0.469032:0.003797:43907:rs372212855
1 69428 rs140739101 T G . PASS AF=0.04215 ES:SE:LP:AF:SS:ID -0.06063:0.1238:0.204607:0.04215:43907:rs140739101
1 69534 rs190717287 T C . PASS AF=0.0003164 ES:SE:LP:AF:SS:ID 0.07667:1.261:0.0215912:0.0003164:43907:rs190717287
1 69761 rs200505207 A T . PASS AF=0.06821 ES:SE:LP:AF:SS:ID 0.03179:0.09492:0.13212:0.06821:43907:rs200505207
1 69897 rs200676709 T C . PASS AF=0.7661 ES:SE:LP:AF:SS:ID -0.02327:0.06099:0.153168:0.7661:43907:rs200676709
1 72297 rs200651397 G GTAT . PASS AF=0.006341 ES:SE:LP:AF:SS:ID 0.3439:0.3331:0.520137:0.006341:43907:rs200651397
1 74790 rs13328700 C G . PASS AF=0.03421 ES:SE:LP:AF:SS:ID 0.09762:0.1224:0.371407:0.03421:43907:rs13328700
1 74792 rs13328684 G A . PASS AF=0.03421 ES:SE:LP:AF:SS:ID 0.09762:0.1224:0.371407:0.03421:43907:rs13328684
1 76854 rs367666799 A G . PASS AF=0.06856 ES:SE:LP:AF:SS:ID 0.01097:0.09841:0.0403386:0.06856:43907:rs367666799
1 78942 rs372315362 C G . PASS AF=0.01116 ES:SE:LP:AF:SS:ID 2.963:1.602:1.19206:0.01116:43907:rs372315362
1 82163 rs139113303 G A . PASS AF=0.06791 ES:SE:LP:AF:SS:ID 0.01662:0.09905:0.0620811:0.06791:43907:rs139113303
1 82609 rs149189449 C G . PASS AF=0.06818 ES:SE:LP:AF:SS:ID 0.008549:0.1053:0.0290491:0.06818:43907:rs149189449
1 83514 rs201754587 C T . PASS AF=0.3501 ES:SE:LP:AF:SS:ID 0.09826:0.0561:1.09778:0.3501:43907:rs201754587
1 84139 rs183605470 A T . PASS AF=0.02132 ES:SE:LP:AF:SS:ID 0.3743:0.1923:1.2871:0.02132:43907:rs183605470
1 86028 rs114608975 T C . PASS AF=0.04742 ES:SE:LP:AF:SS:ID 0.1094:0.119:0.446117:0.04742:43907:rs114608975
1 86065 rs116504101 G C . PASS AF=0.06995 ES:SE:LP:AF:SS:ID 0.03255:0.09751:0.131591:0.06995:43907:rs116504101
1 86331 rs115209712 A G . PASS AF=0.1018 ES:SE:LP:AF:SS:ID 0.02711:0.08754:0.121019:0.1018:43907:rs115209712
1 87021 rs188486692 T C . PASS AF=0.00763 ES:SE:LP:AF:SS:ID -0.2017:0.3029:0.296279:0.00763:43907:rs188486692
1 87360 rs180907504 C T . PASS AF=0.01853 ES:SE:LP:AF:SS:ID 0.1905:0.1726:0.56928:0.01853:43907:rs180907504
1 87409 rs139490478 C T . PASS AF=0.07088 ES:SE:LP:AF:SS:ID 0.02793:0.09669:0.111989:0.07088:43907:rs139490478
1 88169 rs940550 C T . PASS AF=0.2022 ES:SE:LP:AF:SS:ID 0.05539:0.05908:0.457797:0.2022:43907:rs940550
1 88172 rs940551 G A . PASS AF=0.06423 ES:SE:LP:AF:SS:ID 0.05216:0.09892:0.223371:0.06423:43907:rs940551
1 88177 rs143215837 G C . PASS AF=0.06377 ES:SE:LP:AF:SS:ID 0.07074:0.09918:0.322667:0.06377:43907:rs143215837
1 88188 rs148331237 C A . PASS AF=0.007142 ES:SE:LP:AF:SS:ID 0.01146:0.2826:0.0143041:0.007142:43907:rs148331237
1 88236 rs186918018 C T . PASS AF=0.01279 ES:SE:LP:AF:SS:ID -0.3552:0.5178:0.307417:0.01279:43907:rs186918018
1 88316 rs113759966 G A . PASS AF=0.06376 ES:SE:LP:AF:SS:ID 0.08055:0.09928:0.37976:0.06376:43907:rs113759966
1 88338 rs55700207 G A . PASS AF=0.08209 ES:SE:LP:AF:SS:ID 0.156:0.09538:0.9914:0.08209:43907:rs55700207
1 88710 rs186575039 C G . PASS AF=0.07086 ES:SE:LP:AF:SS:ID 0.02813:0.09669:0.112889:0.07086:43907:rs186575039
1 89599 rs375955515 A T . PASS AF=0.07086 ES:SE:LP:AF:SS:ID 0.02813:0.09669:0.112889:0.07086:43907:rs375955515