{
"fileformat": "VCFv4.2",
"FILTER": "<ID=PASS,Description=\"All filters passed\">",
"INFO": "<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency\">",
"FORMAT": "<ID=ES,Number=A,Type=Float,Description=\"Effect size estimate relative to the alternative allele\">",
"FORMAT.1": "<ID=SE,Number=A,Type=Float,Description=\"Standard error of effect size estimate\">",
"FORMAT.2": "<ID=LP,Number=A,Type=Float,Description=\"-log10 p-value for effect estimate\">",
"FORMAT.3": "<ID=AF,Number=A,Type=Float,Description=\"Alternate allele frequency in the association study\">",
"FORMAT.4": "<ID=SS,Number=A,Type=Float,Description=\"Sample size used to estimate genetic effect\">",
"FORMAT.5": "<ID=EZ,Number=A,Type=Float,Description=\"Z-score provided if it was used to derive the EFFECT and SE fields\">",
"FORMAT.6": "<ID=SI,Number=A,Type=Float,Description=\"Accuracy score of summary data imputation\">",
"FORMAT.7": "<ID=NC,Number=A,Type=Float,Description=\"Number of cases used to estimate genetic effect\">",
"FORMAT.8": "<ID=ID,Number=1,Type=String,Description=\"Study variant identifier\">",
"META": "<ID=TotalVariants,Number=1,Type=Integer,Description=\"Total number of variants in input\">",
"META.1": "<ID=VariantsNotRead,Number=1,Type=Integer,Description=\"Number of variants that could not be read\">",
"META.2": "<ID=HarmonisedVariants,Number=1,Type=Integer,Description=\"Total number of harmonised variants\">",
"META.3": "<ID=VariantsNotHarmonised,Number=1,Type=Integer,Description=\"Total number of variants that could not be harmonised\">",
"META.4": "<ID=SwitchedAlleles,Number=1,Type=Integer,Description=\"Total number of variants strand switched\">",
"META.5": "<ID=TotalControls,Number=1,Type=Integer,Description=\"Total number of controls in the association study\">",
"META.6": "<ID=TotalCases,Number=1,Type=Integer,Description=\"Total number of cases in the association study\">",
"META.7": "<ID=StudyType,Number=1,Type=String,Description=\"Type of GWAS study [Continuous or CaseControl]\">",
"SAMPLE": "<ID=ieu-a-1088,TotalVariants=15347572,VariantsNotRead=0,HarmonisedVariants=15347572,VariantsNotHarmonised=0,SwitchedAlleles=0,StudyType=Continuous>",
"contig": "<ID=1,length=249250621,assembly=HG19/GRCh37>",
"contig.1": "<ID=2,length=243199373,assembly=HG19/GRCh37>",
"contig.2": "<ID=3,length=198022430,assembly=HG19/GRCh37>",
"contig.3": "<ID=4,length=191154276,assembly=HG19/GRCh37>",
"contig.4": "<ID=5,length=180915260,assembly=HG19/GRCh37>",
"contig.5": "<ID=6,length=171115067,assembly=HG19/GRCh37>",
"contig.6": "<ID=7,length=159138663,assembly=HG19/GRCh37>",
"contig.7": "<ID=8,length=146364022,assembly=HG19/GRCh37>",
"contig.8": "<ID=9,length=141213431,assembly=HG19/GRCh37>",
"contig.9": "<ID=10,length=135534747,assembly=HG19/GRCh37>",
"contig.10": "<ID=11,length=135006516,assembly=HG19/GRCh37>",
"contig.11": "<ID=12,length=133851895,assembly=HG19/GRCh37>",
"contig.12": "<ID=13,length=115169878,assembly=HG19/GRCh37>",
"contig.13": "<ID=14,length=107349540,assembly=HG19/GRCh37>",
"contig.14": "<ID=15,length=102531392,assembly=HG19/GRCh37>",
"contig.15": "<ID=16,length=90354753,assembly=HG19/GRCh37>",
"contig.16": "<ID=17,length=81195210,assembly=HG19/GRCh37>",
"contig.17": "<ID=18,length=78077248,assembly=HG19/GRCh37>",
"contig.18": "<ID=19,length=59128983,assembly=HG19/GRCh37>",
"contig.19": "<ID=20,length=63025520,assembly=HG19/GRCh37>",
"contig.20": "<ID=21,length=48129895,assembly=HG19/GRCh37>",
"contig.21": "<ID=22,length=51304566,assembly=HG19/GRCh37>",
"contig.22": "<ID=X,length=155270560,assembly=HG19/GRCh37>",
"contig.23": "<ID=Y,length=59373566,assembly=HG19/GRCh37>",
"contig.24": "<ID=MT,length=16569,assembly=HG19/GRCh37>",
"contig.25": "<ID=GL000207.1,length=4262,assembly=HG19/GRCh37>",
"contig.26": "<ID=GL000226.1,length=15008,assembly=HG19/GRCh37>",
"contig.27": "<ID=GL000229.1,length=19913,assembly=HG19/GRCh37>",
"contig.28": "<ID=GL000231.1,length=27386,assembly=HG19/GRCh37>",
"contig.29": "<ID=GL000210.1,length=27682,assembly=HG19/GRCh37>",
"contig.30": "<ID=GL000239.1,length=33824,assembly=HG19/GRCh37>",
"contig.31": "<ID=GL000235.1,length=34474,assembly=HG19/GRCh37>",
"contig.32": "<ID=GL000201.1,length=36148,assembly=HG19/GRCh37>",
"contig.33": "<ID=GL000247.1,length=36422,assembly=HG19/GRCh37>",
"contig.34": "<ID=GL000245.1,length=36651,assembly=HG19/GRCh37>",
"contig.35": "<ID=GL000197.1,length=37175,assembly=HG19/GRCh37>",
"contig.36": "<ID=GL000203.1,length=37498,assembly=HG19/GRCh37>",
"contig.37": "<ID=GL000246.1,length=38154,assembly=HG19/GRCh37>",
"contig.38": "<ID=GL000249.1,length=38502,assembly=HG19/GRCh37>",
"contig.39": "<ID=GL000196.1,length=38914,assembly=HG19/GRCh37>",
"contig.40": "<ID=GL000248.1,length=39786,assembly=HG19/GRCh37>",
"contig.41": "<ID=GL000244.1,length=39929,assembly=HG19/GRCh37>",
"contig.42": "<ID=GL000238.1,length=39939,assembly=HG19/GRCh37>",
"contig.43": "<ID=GL000202.1,length=40103,assembly=HG19/GRCh37>",
"contig.44": "<ID=GL000234.1,length=40531,assembly=HG19/GRCh37>",
"contig.45": "<ID=GL000232.1,length=40652,assembly=HG19/GRCh37>",
"contig.46": "<ID=GL000206.1,length=41001,assembly=HG19/GRCh37>",
"contig.47": "<ID=GL000240.1,length=41933,assembly=HG19/GRCh37>",
"contig.48": "<ID=GL000236.1,length=41934,assembly=HG19/GRCh37>",
"contig.49": "<ID=GL000241.1,length=42152,assembly=HG19/GRCh37>",
"contig.50": "<ID=GL000243.1,length=43341,assembly=HG19/GRCh37>",
"contig.51": "<ID=GL000242.1,length=43523,assembly=HG19/GRCh37>",
"contig.52": "<ID=GL000230.1,length=43691,assembly=HG19/GRCh37>",
"contig.53": "<ID=GL000237.1,length=45867,assembly=HG19/GRCh37>",
"contig.54": "<ID=GL000233.1,length=45941,assembly=HG19/GRCh37>",
"contig.55": "<ID=GL000204.1,length=81310,assembly=HG19/GRCh37>",
"contig.56": "<ID=GL000198.1,length=90085,assembly=HG19/GRCh37>",
"contig.57": "<ID=GL000208.1,length=92689,assembly=HG19/GRCh37>",
"contig.58": "<ID=GL000191.1,length=106433,assembly=HG19/GRCh37>",
"contig.59": "<ID=GL000227.1,length=128374,assembly=HG19/GRCh37>",
"contig.60": "<ID=GL000228.1,length=129120,assembly=HG19/GRCh37>",
"contig.61": "<ID=GL000214.1,length=137718,assembly=HG19/GRCh37>",
"contig.62": "<ID=GL000221.1,length=155397,assembly=HG19/GRCh37>",
"contig.63": "<ID=GL000209.1,length=159169,assembly=HG19/GRCh37>",
"contig.64": "<ID=GL000218.1,length=161147,assembly=HG19/GRCh37>",
"contig.65": "<ID=GL000220.1,length=161802,assembly=HG19/GRCh37>",
"contig.66": "<ID=GL000213.1,length=164239,assembly=HG19/GRCh37>",
"contig.67": "<ID=GL000211.1,length=166566,assembly=HG19/GRCh37>",
"contig.68": "<ID=GL000199.1,length=169874,assembly=HG19/GRCh37>",
"contig.69": "<ID=GL000217.1,length=172149,assembly=HG19/GRCh37>",
"contig.70": "<ID=GL000216.1,length=172294,assembly=HG19/GRCh37>",
"contig.71": "<ID=GL000215.1,length=172545,assembly=HG19/GRCh37>",
"contig.72": "<ID=GL000205.1,length=174588,assembly=HG19/GRCh37>",
"contig.73": "<ID=GL000219.1,length=179198,assembly=HG19/GRCh37>",
"contig.74": "<ID=GL000224.1,length=179693,assembly=HG19/GRCh37>",
"contig.75": "<ID=GL000223.1,length=180455,assembly=HG19/GRCh37>",
"contig.76": "<ID=GL000195.1,length=182896,assembly=HG19/GRCh37>",
"contig.77": "<ID=GL000212.1,length=186858,assembly=HG19/GRCh37>",
"contig.78": "<ID=GL000222.1,length=186861,assembly=HG19/GRCh37>",
"contig.79": "<ID=GL000200.1,length=187035,assembly=HG19/GRCh37>",
"contig.80": "<ID=GL000193.1,length=189789,assembly=HG19/GRCh37>",
"contig.81": "<ID=GL000194.1,length=191469,assembly=HG19/GRCh37>",
"contig.82": "<ID=GL000225.1,length=211173,assembly=HG19/GRCh37>",
"contig.83": "<ID=GL000192.1,length=547496,assembly=HG19/GRCh37>",
"gwas_harmonisation_command": "--json /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ieu-a-1088_data.json --ref /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/QC/genomes/b37/human_g1k_v37.fasta; 1.1.1",
"file_date": "2020-02-04T08:51:49.221102",
"bcftools_annotateVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
"bcftools_annotateCommand": "annotate -a /mnt/storage/home/gh13047/mr-eve/vcf-reference-datasets/dbsnp/dbsnp.v153.b37.vcf.gz -c ID -o /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ieu-a-1088.vcf.gz -O z /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ieu-a-1088_data.vcf.gz; Date=Tue Feb 4 16:09:30 2020",
"bcftools_viewVersion": "1.9-74-g6af271c+htslib-1.9-64-g226b4a8",
"bcftools_viewCommand": "view -h /mnt/storage/private/mrcieu/research/scratch/IGD/data/public/ieu-a-1088/ieu-a-1088.vcf.gz; Date=Sun May 10 23:10:27 2020"
}
*********************************************************************
* LD Score Regression (LDSC)
* Version 1.0.1
* (C) 2014-2019 Brendan Bulik-Sullivan and Hilary Finucane
* Broad Institute of MIT and Harvard / MIT Department of Mathematics
* GNU General Public License v3
*********************************************************************
Call:
./ldsc.py \
--h2 /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ieu-a-1088.vcf.gz \
--ref-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/ \
--out /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ldsc.txt \
--w-ld-chr /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/
Beginning analysis at Wed Feb 5 08:45:14 2020
Reading summary statistics from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/ieu-a-import/processed/ieu-a-1088/ieu-a-1088.vcf.gz ...
Read summary statistics for 15347572 SNPs.
Reading reference panel LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read reference panel LD Scores for 1290028 SNPs.
Removing partitioned LD Scores with zero variance.
Reading regression weight LD Score from /mnt/storage/private/mrcieu/research/scratch/IGD/data/dev/reference/eur_w_ld_chr/[1-22] ...
Read regression weight LD Scores for 1290028 SNPs.
After merging with reference panel LD, 1265487 SNPs remain.
After merging with regression SNP LD, 1265487 SNPs remain.
Using two-step estimator with cutoff at 30.
Total Observed scale h2: 0.0561 (0.005)
Lambda GC: 1.1369
Mean Chi^2: 1.1565
Intercept: 1.0174 (0.0074)
Ratio: 0.1114 (0.0472)
Analysis finished at Wed Feb 5 08:47:47 2020
Total time elapsed: 2.0m:33.13s
{
"af_correlation": 0.9577,
"inflation_factor": 1.0966,
"mean_EFFECT": -0,
"n": 128266,
"n_snps": 15347572,
"n_clumped_hits": 3,
"n_p_sig": 125,
"n_mono": 0,
"n_ns": 897774,
"n_mac": 0,
"is_snpid_unique": true,
"n_miss_EFFECT": 0,
"n_miss_SE": 0,
"n_miss_PVAL": 0,
"n_miss_AF": 0,
"n_miss_AF_reference": 276681,
"n_est": 129391.7313,
"ratio_se_n": 1.0044,
"mean_diff": 5.9697e-07,
"ratio_diff": 0.4811,
"sd_y_est1": 1.0362,
"sd_y_est2": 1.0407,
"r2_sum1": 0.0011,
"r2_sum2": 0.001,
"r2_sum3": 0.001,
"r2_sum4": 0.0011,
"ldsc_nsnp_merge_refpanel_ld": 1265487,
"ldsc_nsnp_merge_regression_ld": 1265487,
"ldsc_observed_scale_h2_beta": 0.0561,
"ldsc_observed_scale_h2_se": 0.005,
"ldsc_intercept_beta": 1.0174,
"ldsc_intercept_se": 0.0074,
"ldsc_lambda_gc": 1.1369,
"ldsc_mean_chisq": 1.1565,
"ldsc_ratio": 0.1112
}
name | value |
---|---|
af_correlation | FALSE |
inflation_factor | FALSE |
n | FALSE |
is_snpid_non_unique | FALSE |
mean_EFFECT_nonfinite | FALSE |
mean_EFFECT_05 | FALSE |
mean_EFFECT_01 | FALSE |
mean_chisq | FALSE |
n_p_sig | FALSE |
miss_EFFECT | FALSE |
miss_SE | FALSE |
miss_PVAL | FALSE |
ldsc_ratio | FALSE |
ldsc_intercept_beta | FALSE |
n_clumped_hits | FALSE |
r2_sum1 | FALSE |
r2_sum2 | FALSE |
r2_sum3 | FALSE |
r2_sum4 | FALSE |
General metrics
af_correlation
: Correlation coefficient between AF
and AF_reference
.inflation_factor
(lambda
): Genomic inflation factor.mean_EFFECT
: Mean of EFFECT
size.n
: Maximum value of reported sample size across all SNPs, \(n\).n_clumped_hits
: Number of clumped hits.n_snps
: Number of SNPsn_p_sig
: Number of SNPs with pvalue below 5e-8
.n_mono
: Number of monomorphic (MAF == 1
or MAF == 0
) SNPs.n_ns
: Number of SNPs with nonsense values:
A, C, G or T
.< 0
or > 1
.<= 0
or = Infinity
).< 0
or > 1
.n_mac
: Number of cases where MAC
(\(2 \times N \times MAF\)) is less than 6
.is_snpid_unique
: true
if the combination of ID
REF
ALT
is unique and therefore no duplication in snpid.n_miss_<*>
: Number of NA
observations for <*>
column.se_n metrics
n_est
: Estimated sample size value, \(\widehat{n}\).ratio_se_n
: \(\texttt{ratio_se_n} = \frac{\sqrt{\widehat{n}}}{\sqrt{n}}\). We expect ratio_se_n
to be 1. When it is not 1, it implies that the trait did not have a variance of 1, the reported sample size is wrong, or that the SNP-level effective sample sizes differ markedly from the reported sample size.mean_diff
: \(\texttt{mean_diff} = \sum_{j} \frac{\widehat{\beta_j^{std}} - \beta_j}{\texttt{n_snps}}\), mean difference between the standardised beta, predicted from P-values, and the observed beta. The difference should be very close to zero if trait has a variance of 1.
ratio_diff
: \(\texttt{ratio_diff} = |\frac{\texttt{mean_diff}}{\texttt{mean_diff2}}|\), absolute ratio between the mean of diff
and the mean of diff2
(expected difference between the standardised beta predicted from P-values, and the standardised beta derived from the observed beta divided by the predicted SD; NOT reported). The ratio should be close to 1. If different from 1, then implies that the betas are not in a standard deviation scale.
sd_y_est1
: The standard deviation for the trait inferred from the reported sample size, median standard errors for the SNP-trait assocations and SNP variances.
sd_y_est2
: The standard deviation for the trait inferred from the reported sample size, Z statistics for the SNP-trait effects (beta/se) and allele frequency.
r2 metrics
Sum of variance explained, calculated from the clumped top hits sample.
r2_sum<*>
: r2
statistics under various assumptions
1
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var1}}}\), \(\texttt{var1} = 1\).2
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var2}}}\), \(\texttt{var2} = {\widehat{\texttt{sd1}}_{y}}^2\),3
: \(r^2 = \sum_j{\frac{2 \times \beta_j^2 \times {MAF}_j \times (1 - {MAF}_j)}{\texttt{var3}}}\), \(\texttt{var3} = {\widehat{\texttt{sd2}}_{y}}^2\),4
: \(r^2 = \sum_j{\frac{F_j}{F_j + n - 2}}\), \(F = \frac{\beta_j^2}{{se}_j^2}\).LDSC metrics
Metrics from LD regression
ldsc_nsnp_merge_refpanel_ld
: Number of remaining SNPs after merging with reference panel LD.ldsc_nsnp_merge_regression_ld
: Number of remaining SNPs after merging with regression SNP LD.ldsc_observed_scale_h2_{beta,se}
Coefficient value and SE for total observed scale h2.ldsc_intercept_{beta,se}
: Coefficient value and SE for intercept. Intercept is expected to be 1.ldsc_lambda_gc
: Lambda GC statistics.ldsc_mean_chisq
: Mean \(\chi^2\) statistics.ldsc_ratio
: \(\frac{\texttt{ldsc_intercept_beta} - 1}{\texttt{ldsc_mean_chisq} - 1}\), the proportion of the inflation in the mean \(\chi^2\) that the LD Score regression intercepts ascribes to causes other than polygenic heritability. The value of ratio should be close to zero, though in practice values of 0.1-0.2 are not uncommon, probably due to sample/reference LD Score mismatch or model misspecification (e.g., low LD variants have slightly higher \(h^2\) per SNP).Flags
When a metric needs attention, the flag should return TRUE.
af_correlation
: abs(af_correlation)
< 0.7.inflation_factor
: inflation_factor
> 1.2.n
: n
(max reported sample size) < 10000.is_snpid_non_unique
: NOT is_snpid_unique
.mean_EFFECT_nonfinite
: mean(EFFECT)
is NA
, NaN
, or Inf
.mean_EFFECT_05
: abs(mean(EFFECT))
> 0.5.mean_EFFECT_01
: abs(mean(EFFECT))
> 0.1.mean_chisq
: ldsc_mean_chisq
> 1.3 or ldsc_mean_chisq
< 0.7.n_p_sig
: n_p_sig
> 1000.miss_<*>
: n_miss_<*>
/ n_snps
> 0.01.ldsc_ratio
: ldsc_ratio
> 0.5ldsc_intercept_beta
: ldsc_intercept_beta
> 1.5n_clumped_hits
: n_clumped_hits
> 1000r2_sum<*>
: r2_sum<*>
> 0.5Plots
skim_type | skim_variable | n_missing | complete_rate | character.min | character.max | character.empty | character.n_unique | character.whitespace | numeric.mean | numeric.sd | numeric.p0 | numeric.p25 | numeric.p50 | numeric.p75 | numeric.p100 | numeric.hist |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
character | ID | 0 | 1.0000000 | 3 | 58 | 0 | 15347571 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
character | REF | 0 | 1.0000000 | 1 | 52 | 0 | 54202 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
character | ALT | 0 | 1.0000000 | 1 | 51 | 0 | 23779 | 0 | NA | NA | NA | NA | NA | NA | NA | NA |
numeric | CHROM | 0 | 1.0000000 | NA | NA | NA | NA | NA | 8.670732e+00 | 5.794802e+00 | 1.00000e+00 | 4.000000e+00 | 8.000000e+00 | 1.300000e+01 | 2.200000e+01 | ▇▅▃▂▂ |
numeric | POS | 0 | 1.0000000 | NA | NA | NA | NA | NA | 7.885565e+07 | 5.646551e+07 | 5.60000e+01 | 3.237004e+07 | 6.949990e+07 | 1.146461e+08 | 2.492397e+08 | ▇▆▅▂▁ |
numeric | EFFECT | 0 | 1.0000000 | NA | NA | NA | NA | NA | -4.700000e-05 | 3.403510e-02 | -3.92363e-01 | -8.634900e-03 | -3.790000e-05 | 8.562300e-03 | 4.335120e-01 | ▁▁▇▁▁ |
numeric | SE | 0 | 1.0000000 | NA | NA | NA | NA | NA | 2.470730e-02 | 2.302450e-02 | 3.91840e-03 | 5.378300e-03 | 1.395020e-02 | 4.110280e-02 | 1.050370e-01 | ▇▂▂▁▁ |
numeric | PVAL | 0 | 1.0000000 | NA | NA | NA | NA | NA | 4.877307e-01 | 2.922355e-01 | 0.00000e+00 | 2.300001e-01 | 4.799997e-01 | 7.400005e-01 | 1.000000e+00 | ▇▇▇▇▇ |
numeric | PVAL_ztest | 0 | 1.0000000 | NA | NA | NA | NA | NA | 4.877300e-01 | 2.922088e-01 | 0.00000e+00 | 2.313979e-01 | 4.836468e-01 | 7.408492e-01 | 9.999999e-01 | ▇▇▇▇▇ |
numeric | AF | 0 | 1.0000000 | NA | NA | NA | NA | NA | 1.569087e-01 | 2.444403e-01 | 1.00000e-03 | 3.104000e-03 | 2.360400e-02 | 2.145052e-01 | 9.990000e-01 | ▇▁▁▁▁ |
numeric | AF_reference | 276681 | 0.9819723 | NA | NA | NA | NA | NA | 1.546682e-01 | 2.328050e-01 | 0.00000e+00 | 1.397800e-03 | 2.915340e-02 | 2.204470e-01 | 1.000000e+00 | ▇▁▁▁▁ |
numeric | N | 0 | 1.0000000 | NA | NA | NA | NA | NA | 1.282660e+05 | 0.000000e+00 | 1.28266e+05 | 1.282660e+05 | 1.282660e+05 | 1.282660e+05 | 1.282660e+05 | ▁▁▇▁▁ |
CHROM | POS | ID | REF | ALT | EFFECT | SE | PVAL | PVAL_ztest | AF | AF_reference | N |
---|---|---|---|---|---|---|---|---|---|---|---|
1 | 10177 | rs367896724 | A | AC | -0.0012131 | 0.0057533 | 0.8300000 | 0.8330013 | 0.399332 | 0.4253190 | 128266 |
1 | 10352 | rs555500075 | T | TA | 0.0069548 | 0.0059753 | 0.2399999 | 0.2444533 | 0.388550 | 0.4375000 | 128266 |
1 | 10511 | rs534229142 | G | A | -0.0741494 | 0.0839495 | 0.3800004 | 0.3770948 | 0.001397 | 0.0001997 | 128266 |
1 | 10616 | rs376342519 | CCGCCGTTGCAAAGGCGCGCCG | C | -0.0042964 | 0.0414097 | 0.9199999 | 0.9173642 | 0.995359 | 0.9930110 | 128266 |
1 | 11008 | rs575272151 | C | G | -0.0035179 | 0.0099355 | 0.7199992 | 0.7232836 | 0.085479 | 0.0880591 | 128266 |
1 | 11012 | rs544419019 | C | G | -0.0035179 | 0.0099355 | 0.7199992 | 0.7232836 | 0.085479 | 0.0880591 | 128266 |
1 | 13110 | rs540538026 | G | A | -0.0024660 | 0.0128005 | 0.8499999 | 0.8472329 | 0.060317 | 0.0267572 | 128266 |
1 | 13116 | rs62635286 | T | G | 0.0192638 | 0.0078154 | 0.0140001 | 0.0137074 | 0.190314 | 0.0970447 | 128266 |
1 | 13273 | rs531730856 | G | C | 0.0001800 | 0.0089813 | 0.9800000 | 0.9840103 | 0.134857 | 0.0950479 | 128266 |
1 | 13453 | rs568927457 | T | C | 0.0032250 | 0.0347879 | 0.9299999 | 0.9261389 | 0.006610 | 0.0007987 | 128266 |
CHROM | POS | ID | REF | ALT | EFFECT | SE | PVAL | PVAL_ztest | AF | AF_reference | N |
---|---|---|---|---|---|---|---|---|---|---|---|
22 | 51238318 | rs541098394 | A | T | 0.0366397 | 0.0402953 | 0.3599996 | 0.3632025 | 0.003814 | 0.0019968 | 128266 |
22 | 51238328 | rs553081191 | A | C | -0.0740063 | 0.0535747 | 0.1700000 | 0.1671663 | 0.001959 | 0.0005990 | 128266 |
22 | 51238364 | rs564490465 | C | G | 0.0635502 | 0.0402925 | 0.1100001 | 0.1147446 | 0.005514 | 0.0005990 | 128266 |
22 | 51238394 | rs149712012 | C | T | 0.0780992 | 0.0446863 | 0.0810009 | 0.0805123 | 0.003340 | 0.0033946 | 128266 |
22 | 51239281 | rs8138215 | G | C | 0.0189335 | 0.0654631 | 0.7700005 | 0.7724100 | 0.001438 | 0.0111821 | 128266 |
22 | 51239296 | rs8137179 | T | C | 0.0189335 | 0.0654631 | 0.7700005 | 0.7724100 | 0.001438 | 0.0111821 | 128266 |
22 | 51239304 | rs8142977 | C | T | 0.0189335 | 0.0654631 | 0.7700005 | 0.7724100 | 0.001438 | 0.0111821 | 128266 |
22 | 51239586 | rs535432390 | T | G | 0.0315207 | 0.0613614 | 0.6100002 | 0.6074692 | 0.001768 | 0.0001997 | 128266 |
22 | 51239794 | rs561893765 | C | A | 0.0285678 | 0.0681500 | 0.6800001 | 0.6750773 | 0.001586 | 0.0299521 | 128266 |
22 | 51244237 | rs575160859 | C | T | 0.0072881 | 0.0244709 | 0.7700005 | 0.7658357 | 0.013177 | 0.0037939 | 128266 |
1 10177 rs367896724 A AC . PASS AF=0.399332 ES:SE:LP:AF:SS:ID -0.00121311:0.00575332:0.0809219:0.399332:128266:rs367896724
1 10352 rs555500075 T TA . PASS AF=0.38855 ES:SE:LP:AF:SS:ID 0.00695484:0.00597532:0.619789:0.38855:128266:rs555500075
1 10511 rs534229142 G A . PASS AF=0.001397 ES:SE:LP:AF:SS:ID -0.0741494:0.0839495:0.420216:0.001397:128266:rs534229142
1 10616 rs376342519 CCGCCGTTGCAAAGGCGCGCCG C . PASS AF=0.995359 ES:SE:LP:AF:SS:ID -0.00429644:0.0414097:0.0362122:0.995359:128266:rs376342519
1 11008 rs575272151 C G . PASS AF=0.085479 ES:SE:LP:AF:SS:ID -0.0035179:0.0099355:0.142668:0.085479:128266:rs575272151
1 11012 rs544419019 C G . PASS AF=0.085479 ES:SE:LP:AF:SS:ID -0.0035179:0.0099355:0.142668:0.085479:128266:rs544419019
1 13110 rs540538026 G A . PASS AF=0.060317 ES:SE:LP:AF:SS:ID -0.00246602:0.0128005:0.0705811:0.060317:128266:rs540538026
1 13116 rs62635286 T G . PASS AF=0.190314 ES:SE:LP:AF:SS:ID 0.0192638:0.00781543:1.85387:0.190314:128266:rs62635286
1 13273 rs531730856 G C . PASS AF=0.134857 ES:SE:LP:AF:SS:ID 0.000179999:0.00898131:0.00877392:0.134857:128266:rs531730856
1 13453 rs568927457 T C . PASS AF=0.00661 ES:SE:LP:AF:SS:ID 0.00322497:0.0347879:0.0315171:0.00661:128266:rs568927457
1 13483 rs554760071 G C . PASS AF=0.005165 ES:SE:LP:AF:SS:ID 0.00970762:0.0394163:0.091515:0.005165:128266:rs554760071
1 14464 rs546169444 A T . PASS AF=0.15676 ES:SE:LP:AF:SS:ID -0.00565505:0.00817964:0.309804:0.15676:128266:rs546169444
1 14604 rs541940975 A G . PASS AF=0.192766 ES:SE:LP:AF:SS:ID 0.0126957:0.00750722:1.04096:0.192766:128266:rs541940975
1 14933 rs199856693 G A . PASS AF=0.047703 ES:SE:LP:AF:SS:ID 0.00150225:0.0138769:0.0409586:0.047703:128266:rs199856693
1 15245 rs576044687 C T . PASS AF=0.001253 ES:SE:LP:AF:SS:ID 0.0298254:0.0768437:0.154902:0.001253:128266:rs576044687
1 15644 rs564003018 G A . PASS AF=0.003492 ES:SE:LP:AF:SS:ID -0.0390967:0.0514119:0.346787:0.003492:128266:rs564003018
1 15820 rs2691315 G T . PASS AF=0.269827 ES:SE:LP:AF:SS:ID 0.00434363:0.00685471:0.275724:0.269827:128266:rs2691315
1 15903 rs557514207 G GC . PASS AF=0.407312 ES:SE:LP:AF:SS:ID -0.0130988:0.00571192:1.65758:0.407312:128266:rs557514207
1 16142 rs548165136 G A . PASS AF=0.002874 ES:SE:LP:AF:SS:ID 0.0534068:0.0552884:0.481486:0.002874:128266:rs548165136
1 16949 rs199745162 A C . PASS AF=0.02072 ES:SE:LP:AF:SS:ID -0.00240505:0.0204146:0.0409586:0.02072:128266:rs199745162
1 18643 rs564023708 G A . PASS AF=0.006362 ES:SE:LP:AF:SS:ID 0.00620082:0.0376476:0.0604807:0.006362:128266:rs564023708
1 18849 rs533090414 C G . PASS AF=0.975399 ES:SE:LP:AF:SS:ID -0.000564197:0.0173475:0.0132283:0.975399:128266:rs533090414
1 30923 rs806731 G T . PASS AF=0.904769 ES:SE:LP:AF:SS:ID -0.0142214:0.0103027:0.769551:0.904769:128266:rs806731
1 46285 rs545414834 ATAT A . PASS AF=0.001688 ES:SE:LP:AF:SS:ID -0.0087602:0.0646436:0.05061:0.001688:128266:rs545414834
1 47159 rs540662756 T C . PASS AF=0.065774 ES:SE:LP:AF:SS:ID 0.00385801:0.0122256:0.124939:0.065774:128266:rs540662756
1 49318 rs536836601 A G . PASS AF=0.001483 ES:SE:LP:AF:SS:ID -0.0787348:0.0713266:0.568636:0.001483:128266:rs536836601
1 49343 rs553572247 T C . PASS AF=0.002075 ES:SE:LP:AF:SS:ID 0.0173639:0.0629753:0.107905:0.002075:128266:rs553572247
1 49554 rs539322794 A G . PASS AF=0.097732 ES:SE:LP:AF:SS:ID 0.00778519:0.0101237:0.356547:0.097732:128266:rs539322794
1 51047 rs559500163 A T . PASS AF=0.001657 ES:SE:LP:AF:SS:ID -0.122172:0.0750829:1:0.001657:128266:rs559500163
1 51049 rs528344458 A C . PASS AF=0.001657 ES:SE:LP:AF:SS:ID -0.122172:0.0750829:1:0.001657:128266:rs528344458
1 51050 rs551668143 A T . PASS AF=0.001657 ES:SE:LP:AF:SS:ID -0.122172:0.0750829:1:0.001657:128266:rs551668143
1 51053 rs565211799 G T . PASS AF=0.001657 ES:SE:LP:AF:SS:ID -0.122172:0.0750829:1:0.001657:128266:rs565211799
1 51479 rs116400033 T A . PASS AF=0.21227 ES:SE:LP:AF:SS:ID -0.0124269:0.0072005:1.07572:0.21227:128266:rs116400033
1 51762 rs559190862 A G . PASS AF=0.008258 ES:SE:LP:AF:SS:ID -0.0273484:0.0331712:0.387216:0.008258:128266:rs559190862
1 51765 rs575564077 C G . PASS AF=0.008077 ES:SE:LP:AF:SS:ID -0.025999:0.0332489:0.366532:0.008077:128266:rs575564077
1 52238 rs2691277 T G . PASS AF=0.978086 ES:SE:LP:AF:SS:ID 0.00332681:0.0212261:0.0555173:0.978086:128266:rs2691277
1 54353 rs140052487 C A . PASS AF=0.001757 ES:SE:LP:AF:SS:ID 0.0557095:0.0597742:0.455932:0.001757:128266:rs140052487
1 54354 rs569165477 C T . PASS AF=0.002372 ES:SE:LP:AF:SS:ID -0.0190674:0.0536911:0.142668:0.002372:128266:rs569165477
1 54490 rs141149254 G A . PASS AF=0.153509 ES:SE:LP:AF:SS:ID -0.0253008:0.00807358:2.76955:0.153509:128266:rs141149254
1 54591 rs561234294 A G . PASS AF=0.002217 ES:SE:LP:AF:SS:ID -0.0529507:0.0595244:0.431798:0.002217:128266:rs561234294
1 54716 rs569128616 C T . PASS AF=0.427168 ES:SE:LP:AF:SS:ID 0.00242313:0.00609542:0.161151:0.427168:128266:rs569128616
1 54945 rs569799965 C A . PASS AF=0.006245 ES:SE:LP:AF:SS:ID -0.0121773:0.0370797:0.130768:0.006245:128266:rs569799965
1 55164 rs3091274 C A . PASS AF=0.982937 ES:SE:LP:AF:SS:ID 0.00335341:0.0233743:0.05061:0.982937:128266:rs3091274
1 55249 rs200769871 C CTATGG . PASS AF=0.009184 ES:SE:LP:AF:SS:ID 0.0370805:0.0292133:0.69897:0.009184:128266:rs200769871
1 55326 rs3107975 T C . PASS AF=0.015693 ES:SE:LP:AF:SS:ID -0.0236057:0.0246687:0.468521:0.015693:128266:rs3107975
1 55405 rs372455836 C T . PASS AF=0.005248 ES:SE:LP:AF:SS:ID 0.0114979:0.0419509:0.107905:0.005248:128266:rs372455836
1 55545 rs28396308 C T . PASS AF=0.259817 ES:SE:LP:AF:SS:ID 0.00817719:0.00682014:0.638272:0.259817:128266:rs28396308
1 56586 rs541979596 G A . PASS AF=0.001126 ES:SE:LP:AF:SS:ID -0.0688798:0.0864226:0.366532:0.001126:128266:rs541979596
1 56829 rs568967163 G T . PASS AF=0.003955 ES:SE:LP:AF:SS:ID 0.00949751:0.0483493:0.0757207:0.003955:128266:rs568967163
1 57292 rs201418760 C T . PASS AF=0.020773 ES:SE:LP:AF:SS:ID -0.0284047:0.0215203:0.721246:0.020773:128266:rs201418760